Proteasome 20S beta 6 (PSMB6) (NM_001270481) Human Untagged Clone
CAT#: SC334506
PSMB6 (untagged) - Human proteasome (prosome, macropain) subunit, beta type, 6 (PSMB6), transcript variant 2
"NM_001270481" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PSMB6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PSMB6 |
Synonyms | DELTA; LMPY; Y |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001270481, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAGGCGTTCACTC CAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTGCAGTTTGACGGGGGCGTGGT TCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATCGCCAATCGAGTGACTGACAAGCTGACACCT ATTCACGACCGCATTTTCTGCTGTCGCTCAGGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCA CCTACCAGCTCGGTTTCCACAGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGCCTCTT TAAGGAGATGTGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGACCCTCAA GAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCCATTGGAGGCT CCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGCATGACCAAGGAAGAGTGTCT GCAATTCACTGCCAATGCTTTCTTCTTTTATCCACAGCTCTCGCTTTGGCCATGGAGCGGGATGGCTCCA GTGGAGGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270481 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270481.1, NP_001257410.1 |
RefSeq Size | 889 bp |
RefSeq ORF | 642 bp |
Locus ID | 5694 |
Cytogenetics | 17p13.2 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.