Carbonic Anhydrase II (CA2) (NM_001293675) Human Untagged Clone
CAT#: SC334056
CA2 (untagged) - Human carbonic anhydrase II (CA2), transcript variant 2
"NM_001293675" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Carbonic Anhydrase II"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Carbonic Anhydrase II |
Synonyms | CA-II; CAC; CAII; Car2; HEL-76; HEL-S-282 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334056 representing NM_001293675.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCATGCTTTCAACGTGGAGTTTGATGACTCTCAGGACAAAGCAGCTTCACTTGGTTCACTGGAAC ACCAAATATGGGGATTTTGGGAAAGCTGTGCAGCAACCTGATGGACTGGCCGTTCTAGGTATTTTTTTG AAGGTTGGCAGCGCTAAACCGGGCCTTCAGAAAGTTGTTGATGTGCTGGATTCCATTAAAACAAAGGGC AAGAGTGCTGACTTCACTAACTTCGATCCTCGTGGCCTCCTTCCTGAATCCTTGGATTACTGGACCTAC CCAGGCTCACTGACCACCCCTCCTCTTCTGGAATGTGTGACCTGGATTGTGCTCAAGGAACCCATCAGC GTCAGCAGCGAGCAGGTGTTGAAATTCCGTAAACTTAACTTCAATGGGGAGGGTGAACCCGAAGAACTG ATGGTGGACAACTGGCGCCCAGCTCAGCCACTGAAGAACAGGCAAATCAAAGCTTCCTTCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293675 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293675.1 |
RefSeq Size | 1547 bp |
RefSeq ORF | 480 bp |
Locus ID | 760 |
Cytogenetics | 8q21.2 |
Protein Families | Druggable Genome |
Protein Pathways | Nitrogen metabolism |
MW | 17.9 kDa |
Gene Summary | The protein encoded by this gene is one of several isozymes of carbonic anhydrase, which catalyzes reversible hydration of carbon dioxide. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (2) lacks an alternate coding exon and initiates translation at a downstream AUG compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.