PPCS (NM_001287506) Human Untagged Clone
CAT#: SC333854
PPCS (untagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 3
"NM_001287506" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PPCS"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPCS |
Synonyms | CMD2C |
Vector | pCMV6-Entry |
Sequence Data |
>SC333854 representing NM_001287506.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTTTACCTGGCTGCGGCTGTGTCAGATTTCTATGTTCCTGTCTCTGAAATGCCTGAACACAAGATC CAGTCATCTGGGGGCCCACTGCAGATAACAATGAAGATGGTGCCAAAACTGCTTTCTCCTTTGGTTAAA GATTGGGCTCCCAAAGCATTTATAATTTCCTTTAAGTTGGAGACTGACCCCGCCATTGTAATTAATCGA GCTCGGAAGGCTTTGGAAATTTATCAGCATCAAGTGGTGGTGGCTAATATCCTTGAGTCACGACAGTCC TTTGTGTTTATTGTAACCAAAGACTCGGAAACCAAGTTATTGCTATCAGAGGAAGAAATAGAAAAAGGC GTAGAGATAGAAGAGAAGATAGTGGATAATCTTCAGTCTCGACACACAGCTTTTATAGGTGACAGAAAC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287506 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287506.1 |
RefSeq Size | 1891 bp |
RefSeq ORF | 417 bp |
Locus ID | 79717 |
UniProt ID | Q9HAB8 |
Cytogenetics | 1p34.2 |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis |
MW | 15.6 kDa |
Gene Summary | Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (3) uses an alternate first exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 5, 6, and 7 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.