Dermcidin (DCD) (NM_001300854) Human Untagged Clone

CAT#: SC333683

DCD (untagged) - Human dermcidin (DCD), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Dermcidin
• Synonyms: AIDD; DCD-1; DSEP; HCAP; PIF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333683 representing NM_001300854.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGTTCATGACTCTCCTCTTCCTGACAGCTCTGGCAGGAGCCCTGGTCTGTGCCTATGATCCAGAG
  GCCGCCTCTGCCCCAGGATCGGGGAACCCTTGCCATGAAGCATCAGCAGCTCAAAAGGAAAATGCAGGT
  GAAGACCCAGGGTTAGCCAGACAGGCACCAAAGCCAAGGAAGCAGAGATCCAGCCTTCTGGAAAAAGGC
  CTAGACGGAGCAAAAAAAGCTGTGGGGGGACTCGGAAAACTAGGAAAAGATGCAGTCGAAGATCTAGAA
  AGCGTGGGTAAAGGTGGGGAAGAGAGGTTGGTCTTTGGGGCTCCTGTGAATCTAACCTCCATCCCTCTG
  ACTTCTGTGAGCCGTCCATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300854
• Insert Size: 366 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300854.1
• RefSeq Size: 709 bp
• RefSeq ORF: 366 bp
• Locus ID: 117159
• UniProt ID: P81605
• Cytogenetics: 12q13.2
• Protein Families: Secreted Protein
• MW: 12.4 kDa
• Gene Summary: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.