PAQR6 (NM_001272109) Human Untagged Clone
CAT#: SC333217
PAQR6 (untagged) - Homo sapiens progestin and adipoQ receptor family member VI (PAQR6), transcript variant 8
"NM_001272109" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PAQR6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAQR6 |
Synonyms | PRdelta |
Vector | pCMV6-Entry |
Sequence Data |
>SC333217 representing NM_001272109.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTACCATCTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGGCTGG CACCAGGACGCTTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGCACCC ACTTCCAGCTGGAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAACCTG CCCTGGGCCTGGCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATTGCTG CTTTCACAGCCACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAGGGGG GTACCCAGGCCAAACAACAGTGAGGCCCCATCCCTGACCCTGTCCTGGAGGGGGCAGAGGCCAGGCCCC AGTGCTGACGAGGAGCCCAGATTTGGGCCTAATCAGGTGGGGACGCATCTCAGCCTGGAACCAACAGGG GCTGAGGAGAGAGGGCACAGGAGAGAGGGCAGAGAAGAGGAGGGGTGTCTAGGGGGACTGGCAGAGTGT GAGAGGGACCGTGAGGGGGCTCTTGATGGGAGTGGAAGAAGTGCTGAGGGTCTGAGAGGGGAGATGCAT GCGTGTCCAGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272109 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001272109.1 |
RefSeq Size | 1961 bp |
RefSeq ORF | 636 bp |
Locus ID | 79957 |
UniProt ID | Q6TCH4 |
Cytogenetics | 1q22 |
Protein Families | Druggable Genome, Transmembrane |
MW | 23.2 kDa |
Gene Summary | Plasma membrane progesterone (P4) receptor coupled to G proteins (PubMed:23763432, PubMed:23161870). Seems to act through a G(s) mediated pathway (PubMed:23161870). Involved in neurosteroid inhibition of apoptosis (PubMed:23161870). May be involved in regulating rapid P4 signaling in the nervous system (PubMed:23763432). Also binds dehydroepiandrosterone (DHEA), pregnanolone, pregnenolone and allopregnanolone (PubMed:23763432, PubMed:23161870).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) has multiple differences and initiates translation at an alternate start codon, compared to variant 1. Variants 8 through 12 encode the same isoform (7), which has a distinct N-terminus and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.