Retinoid X Receptor gamma (RXRG) (NM_001256571) Human Untagged Clone

CAT#: SC332421

RXRG (untagged) - Homo sapiens retinoid X receptor, gamma (RXRG), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Retinoid X Receptor gamma
• Synonyms: NR2B3; RXRC
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332421 representing NM_001256571.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAACTACCCATCCACCAGCCCCGGATCTCTGGTTAAACACATCTGTGCCATCTGTGGAGACAGATCC
  TCAGGAAAGCACTACGGGGTATACAGTTGTGAAGGCTGCAAAGGGTTCTTCAAGAGGACGATAAGGAAG
  GACCTCATCTACACGTGTCGGGATAATAAAGACTGCCTCATTGACAAGCGTCAGCGCAACCGCTGCCAG
  TACTGTCGCTATCAGAAGTGCCTTGTCATGGGCATGAAGAGGGAAGCTGTGCAAGAAGAAAGACAGAGG
  AGCCGAGAGCGAGCTGAGAGTGAGGCAGAATGTGCTACCAGTGGTCATGAAGACATGCCTGTGGAGAGG
  ATTCTAGAAGCTGAACTTGCTGTTGAACCAAAGACAGAATCCTATGGTGACATGAATATGGAGAACTCG
  ACAAATGACCCTGTTACCAACATATGTCATGCTGCTGACAAGCAGCTTTTCACCCTCGTTGAATGGGCC
  AAGCGTATTCCCCACTTCTCTGACCTCACCTTGGAGGACCAGGTCATTTTGCTTCGGGCAGGGTGGAAT
  GAATTGCTGATTGCCTCTTTCTCCCACCGCTCAGTTTCCGTGCAGGATGGCATCCTTCTGGCCACGGGT
  TTACATGTCCACCGGAGCAGTGCCCACAGTGCTGGGGTCGGCTCCATCTTTGACAGAGTCCTAACTGAG
  CTGGTTTCCAAAATGAAAGACATGCAGATGGACAAGTCGGAACTGGGATGCCTGCGAGCCATTGTACTC
  TTTAACCCAGATGCCAAGGGCCTGTCCAACCCCTCTGAGGTGGAGACTCTGCGAGAGAAGGTTTATGCC
  ACCCTTGAGGCCTACACCAAGCAGAAGTATCCGGAACAGCCAGGCAGGTTTGCCAAGCTGCTGCTGCGC
  CTCCCAGCTCTGCGTTCCATTGGCTTGAAATGCCTGGAGCACCTCTTCTTCTTCAAGCTCATCGGGGAC
  ACCCCCATTGACACCTTCCTCATGGAGATGTTGGAGACCCCGCTGCAGATCACCTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256571
• Insert Size: 1023 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256571.1
• RefSeq Size: 1680 bp
• RefSeq ORF: 1023 bp
• Locus ID: 6258
• UniProt ID: P48443
• Cytogenetics: 1q23.3
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Protein Pathways: Adipocytokine signaling pathway, Non-small cell lung cancer, Pathways in cancer, PPAR signaling pathway, Small cell lung cancer, Thyroid cancer
• MW: 38.6 kDa
• Gene Summary: This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (4) uses an alternate internal promoter, and it thus differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as RXRgamma2) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c.