E2F3 (NM_001243076) Human Untagged Clone

CAT#: SC331943

E2F3 (untagged) - Homo sapiens E2F transcription factor 3 (E2F3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: E2F3
• Synonyms: E2F-3
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331943 representing NM_001243076.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCCCTTACAGCAGCAGGCAAAGCGAAGGCTGGAGCTAGGAGAAAGCGGTCATCAGTACCTCTCAGAT
  GGTTTAAAAACCCCCAAGGGCAAAGGAAGAGCTGCACTACGAAGTCCAGATAGTCCAAAAAAAAAAACG
  CGGTATGATACGTCTCTTGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCACCCGATGGG
  GTATTGGATTTGAACAAGGCAGCAGAAGTGCTAAAAGTGCAAAAGAGAAGGATTTATGATATCACCAAC
  GTTCTGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAAAACAACGTCCAATGGATGGGCTGCAGTCTG
  TCTGAGGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCAAAAGAAGTGACCGAGCTCAGTCAGGAA
  GAGAAGAAATTAGATGAACTGATCCAAAGCTGCACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAG
  AATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTT
  ATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACAT
  TTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATG
  AAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAAC
  TCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTA
  CAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCCTGCTG
  CAAGAGGACTATCTCCTGAGCCTCGGGGAGGAGGAAGGCATCAGCGATCTCTTCGATGCTTACGATTTG
  GAAAAGCTCCCACTGGTGGAAGACTTCATGTGTAGTTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243076
• Insert Size: 1005 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243076.2
• RefSeq Size: 4443 bp
• RefSeq ORF: 1005 bp
• Locus ID: 1871
• UniProt ID: O00716
• Cytogenetics: 6p22.3
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer
• MW: 37 kDa
• Gene Summary: This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (2, also known as b) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.