CNTF Receptor alpha (CNTFR) (NM_001207011) Human Untagged Clone

CAT#: SC331734

CNTFR (untagged) - Homo sapiens ciliary neurotrophic factor receptor (CNTFR), transcript variant 3


  "NM_001207011" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CNTF Receptor alpha"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNTF Receptor alpha
Vector pCMV6-Entry
Sequence Data
>SC331734 representing NM_001207011.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGCTCCTGTCCCGTGGGCCTGCTGTGCTGTGCTTGCCGCCGCCGCCGCAGTTGTCTACGCCCAG
AGACACAGTCCACAGGAGGCACCCCATGTGCAGTACGAGCGCCTGGGCTCTGACGTGACACTGCCATGT
GGGACAGCAAACTGGGATGCTGCGGTGACGTGGCGGGTAAATGGGACAGACCTGGCCCCTGACCTGCTC
AACGGCTCTCAGCTGGTGCTCCATGGCCTGGAACTGGGCCACAGTGGCCTCTACGCCTGCTTCCACCGT
GACTCCTGGCACCTGCGCCACCAAGTCCTGCTGCATGTGGGCTTGCCGCCGCGGGAGCCTGTGCTCAGC
TGCCGCTCCAACACTTACCCCAAGGGCTTCTACTGCAGCTGGCATCTGCCCACCCCCACCTACATTCCC
AACACCTTCAATGTGACTGTGCTGCATGGCTCCAAAATTATGGTCTGTGAGAAGGACCCAGCCCTCAAG
AACCGCTGCCACATTCGCTACATGCACCTGTTCTCCACCATCAAGTACAAGGTCTCCATAAGTGTCAGC
AATGCCCTGGGCCACAATGCCACAGCTATCACCTTTGACGAGTTCACCATTGTGAAGCCTGATCCTCCA
GAAAATGTGGTAGCCCGGCCAGTGCCCAGCAACCCTCGCCGGCTGGAGGTGACGTGGCAGACCCCCTCG
ACCTGGCCTGACCCTGAGTCTTTTCCTCTCAAGTTCTTTCTGCGCTACCGACCCCTCATCCTGGACCAG
TGGCAGCATGTGGAGCTGTCCGACGGCACAGCACACACCATCACAGATGCCTACGCCGGGAAGGAGTAC
ATTATCCAGGTGGCAGCCAAGGACAATGAGATTGGGACATGGAGTGACTGGAGCGTAGCCGCCCACGCT
ACGCCCTGGACTGAGGAACCGCGACACCTCACCACGGAGGCCCAGGCTGCGGAGACCACGACCAGCACC
ACCAGCTCCCTGGCACCCCCACCTACCACGAAGATCTGTGACCCTGGGGAGCTGGGCAGCGGCGGGGGA
CCCTCGGCACCCTTCTTGGTCAGCGTCCCCATCACTCTGGCCCTGGCTGCCGCTGCCGCCACTGCCAGC
AGTCTCTTGATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001207011
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001207011.1
RefSeq Size 1946 bp
RefSeq ORF 1119 bp
Locus ID 1271
UniProt ID P26992
Cytogenetics 9p13.3
Protein Families Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
MW 40.6 kDa
Gene Summary This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.