RIC3 (NM_001206672) Human Untagged Clone

CAT#: SC331670

RIC3 (untagged) - Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIC3
• Synonyms: AYST720; PRO1385
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331670 representing NM_001206672.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTG
  CCCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCTGAAGGAAAATTGGGCCGA
  TTTCCACCTATGATGCATCATCACCAGGCACCCTCAGATGGCCAGACTCCTGGGGCTCGTTTCCAGAGG
  TCTCACCTTGCCGAGGCATTTGCAAAGGCCAAAGGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTGGA
  AGAGGTCTGATGGGGCAGATTATTCCAATCTACGGTTTTGGGATTTTTTTATATATACTGTACATTCTA
  TTTAAGCTCTCAAAGGGGAAAACAACTGCAGAGGATGGGAAATGCTATACTGCCATGCCTGGAAACACC
  CACAGGAAAATTAGTTACCCTGAAGAGACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCGTAGG
  CAAGAAACAATCTTGGTGGATTACCCTGACCCAAAAGAACTTTCTGCTGAAGAAATAGCTGAAAGAATG
  GGAATGATAGAAGAGGAAGAATCAGATCATTTGGGTTGGGAAAGTCTGCCCACTGACCCCAGAGCCCAG
  GAAGATAATTCTGTTACCTCGTGTGATCCAAAGCCAGAAACATGTTCCTGCTGTTTTCATGAAGACGAG
  GATCCTGCTGTCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTACCCTGAGCAAGAGGAAACCACC
  AAAGAAGAGTGGTCCCAAGACTTTAAAGATGAAGGGTTGGGCATCAGCACCGATAAAGCATATACAGGC
  AGCATGCTGAGGAAGCGTAACCCCCAGGGTTTAGAGTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206672
• Insert Size: 867 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206672.2
• RefSeq Size: 5587 bp
• RefSeq ORF: 867 bp
• Locus ID: 79608
• UniProt ID: Q7Z5B4
• Cytogenetics: 11p15.4
• Protein Families: Transmembrane
• MW: 31.6 kDa
• Gene Summary: This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
  Transcript Variant: This variant (4) lacks two consecutive exons in the coding region, compared to variant 1. The encoded isoform (e) is shorter than isoform c. The isoform designation was changed from 'd' to 'e' to be consistent with isoforms cited in PMID 18691158. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.