MICOS10-NBL1 (NM_001204088) Human Untagged Clone

CAT#: SC331491

C1orf151 (untagged) - Homo sapiens MINOS1-NBL1 readthrough (MINOS1-NBL1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MICOS10-NBL1
• Synonyms: C1orf151-NBL1; DAN; DAND1; MINOS1-NBL1; NBL1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331491 representing NM_001204088.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGTGAATGCACAGCAACTTCTGGCTCTGGAGGCCACGGGCATGATGCTTCGGGTCCTGGTGGGGGCT
  GTCCTCCCTGCCATGCTACTGGCTGCCCCACCACCCATCAACAAGCTGGCACTGTTCCCAGATAAGAGT
  GCCTGGTGCGAAGCCAAGAACATCACCCAGATCGTGGGCCACAGCGGCTGTGAGGCCAAGTCCATCCAG
  AACAGGGCGTGCCTAGGACAGTGCTTCAGCTACAGCGTCCCCAACACCTTCCCACAGTCCACAGAGTCC
  CTGGTTCACTGTGACTCCTGCATGCCAGCCCAGTCCATGTGGGAGATTGTGACGCTGGAGTGCCCGGGC
  CACGAGGAGGTGCCCAGGGTGGACAAGCTGGTGGAGAAGATCCTGCACTGTAGCTGCCAGGCCTGCGGC
  AAGGAGCCTAGTCACGAGGGGCTGAGCGTCTATGTGCAGGGCGAGGACGGGCCGGGATCCCAGCCCGGC
  ACCCACCCTCACCCCCATCCCCACCCCCATCCTGGCGGGCAGACCCCTGAGCCCGAGGACCCCCCTGGG
  GCCCCCCACACAGAGGAAGAGGGGGCTGAGGACTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204088
• Insert Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204088.1
• RefSeq Size: 2210 bp
• RefSeq ORF: 588 bp
• Locus ID: 100532736
• UniProt ID: P41271
• Cytogenetics: 1p36.13
• MW: 20.8 kDa
• Gene Summary: This locus represents naturally occurring read-through transcription between the neighboring chromosome 1 open reading frame 151 (GeneID 440574) and neuroblastoma suppressor of tumorigenicity 1 (GeneID 4681) genes on chromosome 1. The read-through transcripts produce at least two proteins, each of which share identity with proteins translated from the downstream neuroblastoma suppressor of tumorigenicity 1 locus. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.