TREML1 (NM_001271808) Human Untagged Clone
CAT#: SC330971
TREML1 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells-like 1 (TREML1), transcript variant 3
"NM_001271808" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TREML1 |
Synonyms | dJ238O23.3; GLTL1825; PRO3438; TLT-1; TLT1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330971 representing NM_001271808.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGCCTCACCCTGCTCTTGCTGCTGCTCCTGGGACTAGAAGAGGAAGAAGAAGAGACCCATAAGATT GGCAGTCTGGCTGAGAACGCATTCTCAGACCCTGCAGGCAGTGCCAACCCTTTGGAACCCAGCCAGGAT GAGAAGAGCATCCCCTTGATCTGGGGTGCTGTGCTCCTGGTAGGTCTGCTGGTGGCAGCGGTGGTGCTG TTTGCTGTGATGGCCAAGAGGAAACAAGGGAACAGGCTTGGTGTCTGTGGCCGATTCCTGAGCAGCAGA GTTTCAGGCATGAATCCCTCCTCAGTGGTCCACCACGTCAGTGACTCTGGACCGGCTGCTGAATTGCCT TTGGATGTACCACACATTAGGCTTGACTCACCACCTTCATTTGACAATACCACCTACACCAGCCTACCT CTTGATTCCCCATCAGGAAAACCTTCACTCCCAGCTCCATCCTCATTGCCCCCTCTACCTCCTAAGGTC CTGGTCTGCTCCAAGCCTGTGACATATGCCACAGTAATCTTCCCGGGAGGGAACAAGGGTGGAGGGACC TCGTGTGGGCCAGCCCAGAATCCACCTAACAATCAGACTCCATCCAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271808 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271808.1 |
RefSeq Size | 1023 bp |
RefSeq ORF | 603 bp |
Locus ID | 340205 |
UniProt ID | Q86YW5 |
Cytogenetics | 6p21.1 |
Protein Families | Druggable Genome, Transmembrane |
MW | 20.7 kDa |
Gene Summary | This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012] Transcript Variant: This variant (3) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (c) is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232101 | TREML1 (Myc-DDK tagged) - Homo sapiens triggering receptor expressed on myeloid cells-like 1 (TREML1), transcript variant 3 |
USD 330.00 |
|
RG232101 | TREML1 (tGFP-tagged) - Homo sapiens triggering receptor expressed on myeloid cells-like 1 (TREML1), transcript variant 3 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review