AKR1CL2 (AKR1E2) (NM_001271025) Human Untagged Clone

CAT#: SC330915

AKR1E2 (untagged) - Homo sapiens aldo-keto reductase family 1, member E2 (AKR1E2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AKR1CL2
• Synonyms: AKR1CL2; AKRDC1; htAKR; hTSP; HTSP1; LoopADR; TAKR
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330915 representing NM_001271025.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGGAGATATCCCAGCCGTGGGCCTCAGCTCCTGGAAGGCTTCTCCAGGGAAAGTGACCGAGGCAGTG
  AAAGAGGCCATTGACGCAGGGTACCGGCACTTCGACTGTGCTTACTTTTACCACAATGAGAGGGAGGTT
  GGAGCAGGGATCCGTTGCAAGATCAAGGAAGGCGCTGTAAGACGGGAGGATCTGTTCATTGCCACTAAG
  CTGTGGTGCACCTGCCATAAGAAGTCCTTGGTGGAAACAGCATGCAGAAAGAGTCTCAAGGCCTTGAAG
  CTGAACTATTTGGACCTCTACCTCATACACTGGCCCATGGGTTTCAAGCCTCCTCATCCAGAATGGATC
  ATGAGCTGCAGTGAACTTTCCTTCTGCCTCTCACATCCTCGAGTGCAGGACTTGCCTCTGGACGAGAGC
  AACATGGTTATTCCCAGTGACACGGACTTCCTGGACACGTGGGAGATTTTGATCCGATTTCAAATCCAG
  AGGAATGTGATAGTGATCCCCGGATCTATCACCCCAAGTCACATTAAAGAGAATATCCAGGTGTTTGAT
  TTTGAATTAACACAGCACGATATGGATAACATCCTCAGCCTAAACAGGAATCTCCGACTGGCCATGTTC
  CCCATAACTAAAAATCACAAAGACTATCCTTTCCACATAGAATACTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271025
• Insert Size: 669 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271025.1
• RefSeq Size: 1362 bp
• RefSeq ORF: 669 bp
• Locus ID: 83592
• UniProt ID: Q96JD6
• Cytogenetics: 10p15.1
• Protein Families: Druggable Genome
• MW: 25.7 kDa
• Gene Summary: The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) lacks three alternate in-frame exons in the coding region compared to variant 1. It encodes isoform 3 which is shorter than isoform 1.