THTPA (NM_001256322) Human Untagged Clone

CAT#: SC330395

THTPA (untagged) - Homo sapiens thiamine triphosphatase (THTPA), transcript variant 6


  "NM_001256322" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
THTPA mouse monoclonal antibody, clone OTI3E10 (formerly 3E10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "THTPA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THTPA
Synonyms THTP; THTPASE
Vector pCMV6-Entry
Sequence Data
>SC330395 representing NM_001256322.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAG
GAGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGC
CTCATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCA
GCAGGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTC
TGTGTGCCTGCACAGGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGAC
TATCAGCGCCTGCTAGAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCTGACCACTGC
CTGGGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256322
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256322.2
RefSeq Size 1958 bp
RefSeq ORF 423 bp
Locus ID 79178
UniProt ID Q9BU02
Cytogenetics 14q11.2
Protein Pathways Metabolic pathways, Thiamine metabolism
MW 16 kDa
Gene Summary This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (6) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1. Both variants 6 and 7 encode isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.