SMRP1 (C9orf24) (NM_001252195) Human Untagged Clone

CAT#: SC330277

C9orf24 (untagged) - Homo sapiens chromosome 9 open reading frame 24 (C9orf24), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SMRP1
• Synonyms: bA573M23.4; CBE1; NYD-SP22; SMRP1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330277 representing NM_001252195.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGACAGCAGTTCGAGGAATGCCCTTGGAATGCCCTCCTAGGCCGGAGCGGCTCAATGCCTACGAG
  CGCGAAGTGATGGTGAACATGCTGAACTCACTGTCGCGGAACCAGCAGCTGCCGCGGATCACGCCCCGA
  TGCGGGTGCGTGGACCCGCTGCCCGGCCGCCTGCCCTTCCATGGTTACGAAAGTGCTTGCTCGGGCCGC
  CACTACTGTCTGCGCGGGATGGACTACTACGCCAGCGGGGCGCCCTGCACCGACCGCCGCCTGCGGCCT
  TGGTGCCGGGAGCAACCGACTGTAAGATGTGTACCTCCCTACGAGCACCGGCCCGGAATGCAGTGTGCT
  GTTACAACTCCCCCGCCGTCATACTACCCATATCCGAACCTTAGATGGGACACAAGTCACTTCAAGAAG
  TCTGGTGGTCCCCAGAGAAACAACTATGTTATCCATCCTGAGTTTGTGTCTGAGACCTATCCCGACTAT
  CGTTGCTGGTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252195
• Insert Size: 495 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252195.1
• RefSeq Size: 650 bp
• RefSeq ORF: 495 bp
• Locus ID: 84688
• UniProt ID: Q8NCR6
• Cytogenetics: 9p13.3
• MW: 19.1 kDa
• Gene Summary: This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (4) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR, translation initiation at a downstream, in-frame start codon and a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1.