ETV7 (NM_001207040) Human Untagged Clone

CAT#: SC329891

ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 7


  "NM_001207040" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ETV7 mouse monoclonal antibody, clone OTI2A10 (formerly 2A10)
    • 100 ul

USD 447.00

Other products for "ETV7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ETV7
Synonyms TEL-2; TEL2; TELB
Vector pCMV6-Entry
Sequence Data
>SC329891 representing NM_001207040.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACGGACGCGCCCTCTGCATCCTCACCAAGGACGACTTCCGGCACCGTGCGCCCAGCTCAGGTGAC
GTCCTGTATGAGCTGCTCCAGTACATCAAGACCCAGCGGCGAGCCCTGGTGTGTGGGCCCTTTTTTGGA
GGGATCTTCAGGCTGAAGACGCCCACCCAGCACTCTCCAGTCCCCCCGGAAGAGGTGACTGGCCCCTCT
CAGATGGACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGGCCAC
CTGGATGACCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGTGCA
GAGCTCGGCTGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCAGG
ATCGCTGACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTAC
ATCAAGTGGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGG
GGAAATCACAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAG
CTTAATATCATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATG
GTCCAGGACAAGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGAC
AAGAGGCCAGAAATCTCTCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001207040
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001207040.1
RefSeq Size 1625 bp
RefSeq ORF 783 bp
Locus ID 51513
UniProt ID Q9Y603
Cytogenetics 6p21.31
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation
MW 30 kDa
Gene Summary The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721).[provided by RefSeq, May 2011]
Transcript Variant: This variant (7) lacks an exon in the 5' region compared to variant 1. This results in the creation of two upstream ORFs (uORFs), translation of which will render this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, since both uORFs have weak Kozak signals, translation from an in-frame downstream AUG is possible by leaky scanning, resulting in an isoform (7, also known as Tel-2c) with a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.