ETV7 (NM_001207038) Human Untagged Clone
CAT#: SC329889
ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 5
"NM_001207038" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "ETV7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ETV7 |
Synonyms | TEL-2; TEL2; TELB |
Vector | pCMV6-Entry |
Sequence Data |
>SC329889 representing NM_001207038.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGGAGGGAGAATTGGCTATTTCTCCTATAAGCCCTGTGGCAGCCATGCCTCCCCTAGGCACCCAC GTGCAAGCCAGATGTGAAGCTCAAATTAACCTGCTGGGTGAAGGGGGGATCTGCAAGCTGCCAGGAAGA CTCCGCATCCAGCCCGCACTGTGGAGCAGGGAGGACGTGCTGCACTGGCTGCGCTGGGCAGAGCAGGAG TACTCTCTGCCATGCACCGCGGAGCACGGGTTCGAGATGAACGGACGCGCCCTCTGCATCCTCACCAAG GACGACTTCCGGCACCGTGCGCCCAGCTCAGGTGACGTCCTGTATGAGCTGCTCCAGTACATCAAGACC CAGCGGCGAGCCCTGGTGTGTGGGCCCTTTTTTGGAGGGATCTTCAGGCTGAAGACGCCCACCCAGCAC TCTCCAGTCCCCCCGGAAGACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGA TATGAGCCCTACATCAAGTGGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTC GCCAGACTCTGGGGAAATCACAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGC CACTATTATAAGCTTAATATCATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACT CCGGGAAAGATGGTCCAGGACAAGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATA GAGTTCAAGGACAAGAGGCCAGAAATCTCTCCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207038 |
Insert Size | 795 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001207038.1 |
RefSeq Size | 1521 bp |
RefSeq ORF | 795 bp |
Locus ID | 51513 |
UniProt ID | Q9Y603 |
Cytogenetics | 6p21.31 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Dorso-ventral axis formation |
MW | 30.8 kDa |
Gene Summary | The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721).[provided by RefSeq, May 2011] Transcript Variant: This variant (5) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (5, also known as isoform G) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.