ATP5MD (NM_001206427) Human Untagged Clone

CAT#: SC329808

USMG5 (untagged) - Homo sapiens up-regulated during skeletal muscle growth 5 homolog (mouse) (USMG5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5MD
• Synonyms: bA792D24.4; DAPIT; HCVFTP2; MC5DN6; USMG5
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329808 representing NM_001206427.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCAGGTCCAGAAAGTGATGCGCAATACCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATACT
  CTCACAGGTAGAATGAACTGTGTACTGGCCACATATGGAAGCATTGCATTGATTGTCTTATATTTCAAG
  TTAAGGTCCAAAAAAACTCCAGCTGTGAAAGCAACATAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206427
• Insert Size: 177 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206427.1
• RefSeq Size: 714 bp
• RefSeq ORF: 177 bp
• Locus ID: 84833
• UniProt ID: Q96IX5
• Cytogenetics: 10q24.33
• Protein Families: Transmembrane
• MW: 6.5 kDa
• Gene Summary: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (Probable). Minor subunit required to maintain the ATP synthase population in the mitochondria (PubMed:21345788).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) has an additional exon in the 5' UTR and encodes the same protein, compared to variant 1.