Cytochrome P450 2C8 (CYP2C8) (NM_001198855) Human Untagged Clone

CAT#: SC329477

CYP2C8 (untagged) - Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 4


  "NM_001198855" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CYP2C8 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "CYP2C8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYP2C8
Synonyms CPC8; CYP2C8DM; CYPIIC8; MP-12/MP-20
Vector pCMV6-Entry
Sequence Data
>SC329477 representing NM_001198855.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATCCCATAGTGGTGTTTCATGGATATGAGGCAGTGAAGGAAGCCCTGATTGATAATGGAGAGGAG
TTTTCTGGAAGAGGCAATTCCCCAATATCTCAAAGAATTACTAAAGGACTTGGAATCATTTCCAGCAAT
GGAAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCACAACCTTGCGGAATTTTGGGATGGGGAAGAGG
AGCATTGAGGACCGTGTTCAAGAGGAAGCTCACTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCTTCA
CCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCGTTGTTTTCCAGAAA
CGATTTGATTATAAAGATCAGAATTTTCTCACCCTGATGAAAAGATTCAATGAAAACTTCAGGATTCTG
AACTCCCCATGGATCCAGGTCTGCAATAATTTCCCTCTACTCATTGATTGTTTCCCAGGAACTCACAAC
AAAGTGCTTAAAAATGTTGCTCTTACACGAAGTTACATTAGGGAGAAAGTAAAAGAACACCAAGCATCA
CTGGATGTTAACAATCCTCGGGACTTTATCGATTGCTTCCTGATCAAAATGGAGCAGGAAAAGGACAAC
CAAAAGTCAGAATTCAATATTGAAAACTTGGTTGGCACTGTAGCTGATCTATTTGTTGCTGGAACAGAG
ACAACAAGCACCACTCTGAGATATGGACTCCTGCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTC
CAGGAAGAGATTGATCATGTAATTGGCAGACACAGGAGCCCCTGCATGCAGGATAGGAGCCACATGCCT
TACACTGATGCTGTAGTGCACGAGATCCAGAGATACAGTGACCTTGTCCCCACCGGTGTGCCCCATGCA
GTGACCACTGATACTAAGTTCAGAAACTACCTCATCCCCAAGGGCACAACCATAATGGCATTACTGACT
TCCGTGCTACATGATGACAAAGAATTTCCTAATCCAAATATCTTTGACCCTGGCCACTTTCTAGATAAG
AATGGCAACTTTAAGAAAAGTGACTACTTCATGCCTTTCTCAGCAGGAAAACGAATTTGTGCAGGAGAA
GGACTTGCCCGCATGGAGCTATTTTTATTTCTAACCACAATTTTACAGAACTTTAACCTGAAATCTGTT
GATGATTTAAAGAACCTCAATACTACTGCAGTTACCAAAGGGATTGTTTCTCTGCCACCCTCATACCAG
ATCTGCTTCATCCCTGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001198855
Insert Size 1263 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001198855.1
RefSeq Size 2024 bp
RefSeq ORF 1263 bp
Locus ID 1558
UniProt ID P10632
Cytogenetics 10q23.33
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Arachidonic acid metabolism, Drug metabolism - cytochrome P450, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism
MW 47.8 kDa
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, benzo(a)pyrene, 7-ethyoxycoumarin, and the anti-cancer drug taxol. This gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 4 both encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.