ORC4L (ORC4) (NM_001190879) Human Untagged Clone

CAT#: SC329421

ORC4 (untagged) - Homo sapiens origin recognition complex, subunit 4 (ORC4), transcript variant 4


  "NM_001190879" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ORC4 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "ORC4L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ORC4L
Synonyms ORC4L; ORC4P
Vector pCMV6-Entry
Sequence Data
>SC329421 representing NM_001190879.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCAGTCGTAAATCAAAGAGTAACAGCTTAATTCACACAGAGTGCCTTTCACAGGTACAAAGAATT
TTACGTGAAAGATTTTGTCGTCAGAGTCCACATAGTAACCTATTTGGAGTGCAAGTACAATACAAACAC
TTAAGTGAGCTGCTGAAAAGAACTGCTCTCCATGGAGAGAGTAACTCTGTCCTTATTATCGGACCCCGA
GGATCAGGAAAAACTATGTTAATAAATCATGCTTTGAAAGAACTCATGGAAATAGAAGAAGTGAGTGAA
AATGTATTACAAGTTCACTTAAATGGACTGCTGCAGATCAATGACAAAATCGCCCTAAAGGAAATCACA
AGGCAGTTAAATCTGGAAAATGTAGTTGGAGATAAAGTTTTTGGAAGCTTTGCTGAAAACCTTTCATTT
CTTCTGGAAGCTTTAAAAAAAGGTGACCGAACTAGCAGTTGCCCAGTGATCTTCATATTAGATGAATTT
GATCTTTTTGCTCATCATAAAAACCAAACACTTCTCTATAATCTTTTTGACATTTCTCAGTCTGCACAG
ACCCCAATAGCAGTTATTGGTCTTACATGTAGATTGGATATTTTGGAACTCTTAGAAAAAAGAGTGAAG
TCAAGATTTTCTCACCGGCAGATACACTTAATGAATTCATTTGGTTTTCCACAGTATGTTAAAATATTT
AAAGAACAGTTATCTCTACCTGCAGAGTTTCCAGACAAGGTTTTTGCTGAGAAGTGGAATGAAAATGTT
CAGTATCTCTCAGAAGATAGAAGTGTGCAAGAAGTACTACAGAAGCATTTCAATATCAGCAAAAACCTG
CGGTCATTACACATGCTATTGATGCTTGCTTTAAATCGAGTAACAGCATCGCACCCATTTATGACTGCC
GTAGATCTAATGGAAGCAAGCCAACTGTGTAGCATGGACTCGAAAGCAAATATTGTACATGGTCTATCA
GTCTTGGAAATCTGTCTTATAATAGCAATGAAACATTTAAATGACATCTATGAGGAAGAGCCATTTAAT
TTTCAAATGGTCTATAATGAGTTTCAGAAGTTTGTTCAAAGGAAAGCACATTCCGTTTATAATTTTGAA
AAACCTGTTGTCATGAAGGCTTTTGAACACTTGCAGCAATTAGAATTAATAAAGCCCATGGAAAGAACT
TCAGGAAATTCACAGAGAGAGTACCAGCTGATGAAACTGCTTTTGGATAATACTCAAATTATGAATGCT
CTGCAGAAATATCCCAACTGTCCTACAGATGTGAGGCAGTGGGCAACATCCTCACTAAGCTGGTTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001190879
Insert Size 1311 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001190879.2
RefSeq Size 6710 bp
RefSeq ORF 1311 bp
Locus ID 5000
UniProt ID O43929
Cytogenetics 2q23.1
Protein Pathways Cell cycle
MW 50.4 kDa
Gene Summary The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (4) represents the longest transcript. Variants 1 through 4 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.