CITED2 (NM_001168389) Human Untagged Clone

CAT#: SC328440

CITED2 (untagged)-Human Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) transcript variant 3


  "NM_001168389" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal CITED2 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CITED2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CITED2
Synonyms ASD8; MRG-1; MRG1; P35SRJ; VSD2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001168389, the custom clone sequence may differ by one or more nucleotides
ATGGCAGACCATATGATGGCCATGAACCACGGGCGCTTCCCCGACGGCACCAATGGGCTG
CACCATCACCCTGCCCACCGCATGGGCATGGGGCAGTTCCCGAGCCCCCATCACCACCAG
CAGCAGCAGCCCCAGCACGCCTTCAACGCCCTAATGGGCGAGCACATACACTACGGCGCG
GGCAACATGAATGCCACGAGCGGCATCAGGCATGCGATGGGGCCGGGGACTGTGAACGGA
GGGCACCCCCCGAGCGCGCTGGCCCCCGCGGCCAGGTTTAACAACTCCCAGTTCATGGGT
CCCCCGGTGGCCAGCCAGGGAGGCTCCCTGCCGGCCAGCATGCAGCTGCAGAAGCTCAAC
AACCAGTATTTCAACCATCACCCCTACCCCCACAACCACTACATGCCGGATTTGCACCCT
GCTGCAGGCCACCAGATGAACGGGACAAACCAGCACTTCCGAGATTGCAACCCCAAGCAC
AGCGGCGGCAGCAGCACCCCCGGCGGCTCGGGCGGCAGCAGCACCCCCGGCGGCTCTGGC
AGCAGCTCGGGCGGCGGCGCGGGCAGCAGCAACAGCGGCGGCGGCAGCGGCAGCGGCAAC
ATGCCCGCCTCCGTGGCCCACGTCCCCGCTGCAATGCTGCCGCCCAATGTCATAGACACT
GATTTCATCGACGAGGAAGTTCTTATGTCCTTGGTGATAGAAATGGGTTTGGACCGCATC
AAGGAGCTGCCCGAACTCTGGCTGGGGCAAAACGAGTTTGATTTTATGACGGACTTCGTG
TGCAAACAGCAGCCCAGCAGAGTGAGCTGTTGA
Restriction Sites Please inquire     
ACCN NM_001168389
Insert Size 1780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001168389.1, NP_001161861.1
RefSeq Size 1780 bp
RefSeq ORF 813 bp
Locus ID 10370
UniProt ID Q99967
Cytogenetics 6q24.1
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.