CD99L2 (NM_001184808) Human Untagged Clone

CAT#: SC328294

CD99L2 (untagged)-Human CD99 molecule-like 2 (CD99L2) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD99L2
• Synonyms: CD99B; MIC2L1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC328294 representing NM_001184808.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGGCCTGGCGCTCGGCGTTCCTTGTCTGCCTCGCTTTCTCCTTGGCCACCCTGGTCCAGCGAGGA
  TCTGGGGACTTTGATGATTTTAACCTGGAGGATGCAGTGAAAGAAACTTCCTCAGTAAAGCAGCCATGG
  GACCACACCACCACCACCACAACCAATAGGCCAGGAACCACCAGAGCTCCGGCAAAACCTCCAGGTAGT
  GGATTGGACTTGGCTGATGCTTTGGATGATCAAGATGATGGCCGCAGGAAACCGGGTATAGGAGGAAGA
  GGTGATGGCCGGTACGGCAGCAATGACGACCCTGGATCTGGCATGGTGGCAGAGCCTGGCACCATTGCC
  GGGGTGGCCAGCGCCCTGGCCATGGCCCTCATCGGTGCCGTCTCCAGCTACATCTCCTACCAGCAGAAG
  AAGTTCTGCTTCAGCATTCAGCAGGGTCTCAACGCAGACTACGTGAAGGGAGAGAACCTGGAAGCCGTG
  GTATGTGAGGAACCCCAAGTGAAATACTCCACGTTGCACACGCAGTCTGCAGAGCCGCCGCCGCCGCCC
  GAACCAGCCCGGATCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001184808
• Insert Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001184808.1
• RefSeq Size: 3517 bp
• RefSeq ORF: 570 bp
• Locus ID: 83692
• UniProt ID: Q8TCZ2
• Cytogenetics: Xq28
• Protein Families: Transmembrane
• MW: 20 kDa
• Gene Summary: This gene encodes a cell-surface protein that is similar to CD99. A similar protein in mouse functions as an adhesion molecule during leukocyte extravasation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (4) lacks three consecutive in-frame exons in one region and an in-frame exon in another region, compared to variant 5. The resulting isoform (4) lacks two internal segments, compared to isoform 5.