ALG3 (NM_001006941) Human Untagged Clone

CAT#: SC325864

ALG3 (untagged)-Human asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) (ALG3), transcript variant 4


  "NM_001006941" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ALG3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALG3
Synonyms CDG1D; CDGS4; CDGS6; D16Ertd36e; not; Not56; NOT56L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325864 representing NM_001006941.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCCAGCGCAGGCGAAGGAGAATGCTGGCTTCAGCGGTTGTGGGGGAGACACAGAGATTGACTGG
AAGGCCTACATGGCCGAGGTAGAAGGCGTCATCAATGGTACCTATGACTATACCCAACTGCAGGGTGAC
ACCGGACCACTTGTGTACCCAGCTGGTTTCGTGTACATCTTTATGGGGTTGTACTATGCCACCAGCCGA
GGCACTGACATCCGCATGGCCCAGAACATCTTTGCTGTGCTCTACCTGGCTACCTTGCTGCTTGTCTTC
TTGATCTATCACCAGACCTGCAAGGTACCTCCCTTCGTCTTTTTCTTCATGTGCTGCGCCTCTTACCGT
GTCCACTCCATCTTTGTGCTGCGGCTCTTCAATGACCCAGTGGCCATGGTGCTGCTCTTCCTCAGTATC
AACCTCCTGCTGGCCCAGCGCTGGGGCTGGGGTTGCTGCTTTTTCAGCCTGGCAGTCTCTGTGAAGATG
AATGTGCTGCTCTTCGCCCCTGGGTTACTGTTTCTTCTCCTCACACAGTTTGGCTTCCGTGGGGCCCTC
CCCAAGCTGGGAATCTGTGCTGGCCTTCAGGTGGTGCTGGGGCTGCCCTTCCTGCTGGAGAACCCCAGC
GGCTACCTGTCCCGCTCCTTTGACCTTGGCCGCCAGTTTCTGTTCCACTGGACAGTGAACTGGCGCTTC
CTCCCAGAGGCGCTCTTCCTGCATCGAGCCTTCCACCTGGCCCTGTTGACTGCCCACCTCACCCTGCTC
CTGCTGTTTGCCCTCTGCAGGTGGCACAGGACAGGGGAAAGTATCTTGTCGCTGCTGAGGGATCCCTCC
AAAAGGAAGGTTCCACCCCAGCCCCTTACACCCAACCAGATCGTTTCTACCCTCTTCACCTCCAACTTC
ATTGGCATCTGCTTCAGCCGCTCCCTCCACTACCAGTTCTACGTCTGGTATTTCCACACACTGCCCTAC
CTCCTGTGGGCCATGCCTGCACGCTGGCTCACACACCTGCTCAGGTTGTTGGTGCTGGGGCTCATCGAG
CTCTCCTGGAACACATACCCTTCCACATCCTGCAGCTCTGCTGCCCTGCACATATGCCATGCCGTCATC
CTGCTGCAGCTCTGGCTGGGCCCGCAGCCTTTCCCCAAGAGCACCCAACACAGCAAGAAAGCCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006941
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006941.2
RefSeq Size 1623 bp
RefSeq ORF 1173 bp
Locus ID 10195
UniProt ID Q92685
Cytogenetics 3q27.1
Protein Families Transmembrane
Protein Pathways Metabolic pathways, N-Glycan biosynthesis
MW 44.4 kDa
Gene Summary This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (d) has a shorter and distinct N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.