LANCL1 (NM_001136575) Human Untagged Clone

CAT#: SC325048

LANCL1 (untagged)-Human LanC lantibiotic synthetase component C-like 1 (bacterial) (LANCL1), transcript variant 3


  "NM_001136575" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
LANCL1 Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LANCL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LANCL1
Synonyms GPR69A; p40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325048 representing NM_001136575.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCAAAGGGCCTTCCCGAATCCTTATGCTGATTATAACAAATCCCTGGCCGAAGGCTACTTTGAT
GCTGCCGGGAGGCTGACTCCTGAGTTCTCACAACGCTTGACCAATAAGATTCGGGAGCTTCTTCAGCAA
ATGGAGAGAGGCCTGAAATCAGCAGACCCTCGGGATGGCACCGGTTACACTGGCTGGGCAGGTATTGCT
GTGCTTTACTTACATCTTTATGATGTATTTGGGGACCCTGCCTACCTACAGTTAGCACATGGCTATGTA
AAGCAAAGTCTGAACTGCTTAACCAAGCGCTCCATCACCTTCCTTTGTGGGGATGCAGGCCCCCTGGCA
GTGGCCGCTGTGCTATATCACAAGATGAACAATGAGAAGCAGGCAGAAGATTGCATCACACGGCTAATT
CACCTAAATAAGATTGATCCTCATGCTCCAAATGAAATGCTCTATGGGCGAATAGGCTACATCTATGCT
CTTCTTTTTGTCAATAAGAACTTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAGCAGATTTGTGAA
ACAATTTTAACCTCTGGAGAAAACCTAGCTAGGAAGAGAAACTTCACGGCAAAGTCTCCACTGATGTAT
GAATGGTACCAGGAATATTATGTAGGGGCTGCTCATGGCCTGGCTGGAATTTATTACTACCTGATGCAG
CCCAGCCTTCAAGTGAGCCAAGGGAAGTTACATAGTTTGGTCAAGCCCAGTGTAGACTACGTCTGCCAG
CTGAAATTCCCTTCTGGCAATTACCCTCCATGTATAGGTGATAATCGAGATCTGCTTGTCCATTGGTGC
CATGGCGCCCCTGGGGTAATCTACATGCTCATCCAGGCCTATAAGGTATTCAGAGAGGAAAAGTATCTC
TGTGATGCCTATCAGTGTGCTGATGTGATCTGGCAATATGGGTTGCTGAAGAAGGGATATGGGCTGTGC
CACGGTTCTGCAGGGAATGCCTATGCCTTCCTGACACTCTACAACCTCACACAGGACATGAAGTACCTG
TATAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAACATGGATGCAGAACACCAGACACC
CCTTTCTCTCTCTTTGAAGGAATGGCTGGAACAATATATTTCCTGGCTGACCTGCTAGTCCCCACAAAA
GCCAGGTTCCCTGCATTTGAACTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136575
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136575.1
RefSeq Size 4526 bp
RefSeq ORF 1200 bp
Locus ID 10314
UniProt ID O43813
Cytogenetics 2q34
Protein Families Druggable Genome
MW 45.3 kDa
Gene Summary This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.