HPGDS (NM_014485) Human Untagged Clone

CAT#: SC324532

HPGDS (untagged)-Human hematopoietic prostaglandin D synthase (HPGDS)


  "NM_014485" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PGDS Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HPGDS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HPGDS
Synonyms GSTS; GSTS1; GSTS1-1; PGD2; PGDS
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_014485.2 GGCACAGTCACATACCCAGGGATACAAGACACTGCAGACTCCCGAGAGACATAACACAGA
ATTGCACCATGCCAAACTACAAACTCACTTATTTTAATATGAGGGGGAGAGCAGAAATTA
TTCGTTACATATTTGCTTATTTGGACATACAGTATGAAGACCACAGAATAGAACAAGCTG
ACTGGCCTGAAATCAAATCAACTCTCCCATTTGGAAAAATCCCCATTTTGGAAGTTGATG
GACTTACTCTTCACCAGAGCCTAGCAATAGCAAGATATTTGACCAAAAACACAGATTTGG
CTGGAAACACAGAAATGGAACAATGTCATGTTGATGCTATTGTGGACACTCTGGATGATT
TCATGTCATGTTTTCCTTGGGCAGAGAAAAAGCAAGATGTGAAAGAGCAGATGTTCAATG
AGCTGCTCACGTATAATGCGCCTCATCTTATGCAAGACTTGGACACATATTTAGGGGGGA
GAGAATGGCTTATTGGTAACTCTGTAACTTGGGCAGACTTCTACTGGGAGATTTGCAGTA
CCACACTTTTGGTCTTTAAGCCTGACCTGTTAGACAACCATCCAAGGCTGGTGACTTTAC
GGAAGAAAGTCCAAGCCATTCCTGCCGTCGCTAACTGGATAAAACGAAGGCCCCAAACCA
AACTCTAGCTGATCCATGTTGCCTTCAAGTTTGTTTTTCTCGGGGGCATCTCTCTCATCA
GATAAGACAGCTACATCAGCCTGCCAGATAATCCACATGCTCCCTCCCCAGCTCCACTAA
GATTTTCACTTTAGCCATATTCTGATTTTTAAAAAGGAAAATAAAAACAAATCTTTCTTC
AGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
AAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_014485
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014485.2, NP_055300.1
RefSeq Size 1615 bp
RefSeq ORF 600 bp
Locus ID 27306
UniProt ID O60760
Cytogenetics 4q22.3
Domains GST_N, GST_C
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary Prostaglandin-D synthase is a sigma class glutathione-S-transferase family member. The enzyme catalyzes the conversion of PGH2 to PGD2 and plays a role in the production of prostanoids in the immune system and mast cells. The presence of this enzyme can be used to identify the differentiation stage of human megakaryocytes. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.