HPGDS (NM_014485) Human Untagged Clone

CAT#: SC114983

HPGDS (untagged)-Human hematopoietic prostaglandin D synthase (HPGDS)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HPGDS (NM_014485) Human Untagged Clone
Symbol HPGDS
Synonyms GSTS; GSTS1; GSTS1-1; PGD2; PGDS
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC114983 sequence for NM_014485 edited (data generated by NextGen Sequencing)
ATGCCAAACTACAAACTCACTTATTTTAATATGAGGGGGAGAGCAGAAATTATTCGTTAC
ATATTTGCTTATTTGGACATACAGTATGAAGACCACAGAATAGAACAAGCTGACTGGCCT
GAAATCAAATCAACTCTCCCATTTGGAAAAATCCCCATTTTGGAAGTTGATGGACTTACT
CTTCACCAGAGCCTAGCAATAGCAAGATATTTGACCAAAAACACAGATTTGGCTGGAAAC
ACAGAAATGGAACAATGTCATGTTGATGCTATTGTGGACACTCTGGATGATTTCATGTCA
TGTTTTCCTTGGGCAGAGAAAAAGCAAGATGTGAAAGAGCAGATGTTCAATGAGCTGCTC
ACGTATAATGCGCCTCATCTTATGCAAGACTTGGACACATATTTAGGGGGGAGAGAATGG
CTTATTGGTAACTCTGTAACTTGGGCAGACTTCTACTGGGAGATTTGCAGTACCACACTT
TTGGTCTTTAAGCCTGACCTGTTAGACAACCATCCAAGGCTGGTGACTTTACGGAAGAAA
GTCCAAGCCATTCCTGCCGTCGCTAACTGGATAAAACGAAGGCCCCAAACCAAACTCTAG

Clone variation with respect to NM_014485.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_014485 unedited
TGCGGATTTGTATACGACTCATATAGGGCGGCCGCGAATCGGCACGAGGACTTACTCGTC
ATATAAACCCAAGGCACAGTCACATACCCAGGGATACAAGACACTGCAGACTCCCGAGAG
ACATAACACAGAATTGCACCATGCCAAACTACAAACTCACTTATTTTAATATGAGGGGGA
GAGCAGAAATTATTCGTTACATATTTGCTTATTTGGACATACAGTATGAAGACCACAGAA
TAGAACAAGCTGACTGGCCTGAAATCAAATCAACTCTCCCATTTGGAAAAATCCCCATTT
TGGAAGTTGATGGACTTACTCTTCACCAGAGCCTAGCAATAGCAAGATATTTGACCAAAA
ACACAGATTTGGCTGGAAACACAGAAATGGAACAATGTCATGTTGATGCTATTGTGGACA
CTCTGGATGATTTCATGTCATGTTTTCCTTGGGCAGAGAAAAAGCAAGATGTGAAAGAGC
AGATGTTCAATGAGCTGCTCACGTATAATGCGCCTCATCTTATGCAAGACTTGGACACAT
ATTTAGGGGGGAGAGAATGGCTTATTGGTAACTCTGTAACTTGGGCAGACTTCTACTGGG
AGATTTGCAGTACCACACTTTTGGTCTTTAAGCCTGACCTGTTAGACAACCATCCAAGGC
TGGTGACTTTACGGAAGNAAGTCCAAGCCATTCCTGCCGTCGCTAACTGGATAAAACGAA
GGCCCCAAACCAAACTCTAGCTGATCCATGTTGCCCTCAAGTTTTGTTTTCTTCGGGGCA
TCTCTCTTATCAGATAGACAGCTACATCAGCCTGCCAGATATCCACATGCTCCCTCCCCA
GCGTCACTAAGATTTTCACTTTTACCATATTCTGATTTTTAAAAGGAAAAAAAAACAAAT
CTTTTTTAGTAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_014485
ORF Size 600 bp
Insert Size 6000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_014485.2, NP_055300
RefSeq Size 1615
RefSeq ORF 600
Locus ID 27306
Cytogenetics 4q22.3
Domains GST_N, GST_C
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary Prostaglandin-D synthase is a sigma class glutathione-S-transferase family member. The enzyme catalyzes the conversion of PGH2 to PGD2 and plays a role in the production of prostanoids in the immune system and mast cells. The presence of this enzyme can be used to identify the differentiation stage of human megakaryocytes. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations