ART3 (NM_001130017) Human Untagged Clone

CAT#: SC323007

ART3 (untagged)-Human ADP-ribosyltransferase 3 (ART3), transcript variant 3


  "NM_001130017" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-ART3 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ART3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ART3
Synonyms ARTC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323007 representing NM_001130017.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGACGGGACATTTTGAAATAGTCACCATGCTGCTGGCAACCATGATTCTAGTGGACATTTTCCAG
GTGAAGGCTGAAGTGTTAGACATGGCAGATAATGCATTTGATGATGAATACCTGAAATGTACGGACAGG
ATGGAAATTAAATACGTTCCCCAACTGCTAAAGGAGGAAAAAGCAAGCCACCAGCAATTAGATACTGTG
TGGGAAAATGCAAAAGCCAAATGGGCAGCCCGAAAGACTCAAATCTTTCTCCCTATGAATTTTAAGGAT
AACCATGGAATAGCCCTGATGGCATATATTTCCGAAGCTCAAGAGCAAACTCCCTTTTACCATCTGTTC
AGTGAAGCTGTGAAGATGGCTGGCCAATCTCGAGAAGATTATATCTATGGCTTCCAGTTCAAAGCTTTC
CACTTTTACCTCACAAGAGCCCTGCAGTTGCTGAGAAAACCTTGTGAGGCCAGTTCCAAAACTGTGGTA
TATAGAACAAGCCAGGGCACTTCATTTACATTTGGAGGGCTAAACCAAGCCAGGTTTGGCCATTTTACC
TTGGCATATTCAGCCAAACCTCAGGCTGCTAATGACCAGCTCACTGTGTTATCCATCTACACATGCCTT
GGAGTTGACATTGAAAATTTTCTTGATAAAGAAAGTGAAAGAATTACTTTAATACCTCTGAATGAGGTT
TTTCAAGTGTCACAGGAGGGGGCTGGCAATAACCTTATCCTTCAAAGCATAAACAAGACCTGCAGCCAT
TATGAGTGTGCATTTCTAGGTGGACTAAAAACCGAAAACTGTATTGAGAACCTAGAATATTTTCAACCC
ATCTATGTCTACAACCCTGGTGAGAAAAACCAGAAGCTTGAAGACCATAGTGAGAAAAACTGGAAGCTT
GAAGACCATGGTGAGAAAAACCAGAAGCTTGAAGACCATGGTGTGAAAATCCTTGAACCCACCCAAATA
CCTGCTCCAGGTCCAGTTCCTGTTCCAGGTCCCAAAAGCCATCCTTCTGCATCCTCGGGCAAACTGCTG
CTTCCACAGTTTGGGATGGTCATCATTTTAATCAGTGTTTCTGCTATAAATCTCTTTGTTGCTCTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130017
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130017.2
RefSeq Size 1563 bp
RefSeq ORF 1104 bp
Locus ID 419
UniProt ID Q13508
Cytogenetics 4p15.1-p14
Protein Families Transmembrane
MW 41.5 kDa
Gene Summary This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) lacks an alternate in-frame segment and differs in the 5' UTR compared to variant 1. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.