RPL8 (NM_000973) Human Untagged Clone
CAT#: SC321023
RPL8 (untagged)-Human ribosomal protein L8 (RPL8), transcript variant 1
"NM_000973" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPL8 |
Synonyms | L8 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000973.3
AGATAAGGCCGCTCGCTGACGCCGTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCC
GTCGCCATGGGCCGTGTGATCCGTGGACAGAGGAAGGGCGCCGGGTCTGTGTTCCGCGCG CACGTGAAGCACCGTAAAGGCGCTGCGCGCCTGCGCGCCGTGGATTTCGCTGAGCGGCAC GGCTACATCAAGGGCATCGTCAAGGACATCATCCACGACCCGGGCCGCGGCGCGCCCCTC GCCAAGGTGGTCTTCCGGGATCCGTATCGGTTTAAGAAGCGGACGGAGCTGTTCATTGCC GCCGAGGGCATTCACACGGGCCAGTTTGTGTATTGCGGCAAGAAGGCCCAGCTCAACATT GGCAATGTGCTCCCTGTGGGCACCATGCCTGAGGGTACAATCGTGTGCTGCCTGGAGGAG AAGCCTGGAGACCGTGGCAAGCTGGCCCGGGCATCAGGGAACTATGCCACCGTTATCTCC CACAACCCTGAGACCAAGAAGACCCGTGTGAAGCTGCCCTCCGGCTCCAAGAAGGTTATC TCCTCAGCCAACAGAGCTGTGGTTGGTGTGGTGGCTGGAGGTGGCCGAATTGACAAACCC ATCTTGAAGGCTGGCCGGGCGTACCACAAATATAAGGCAAAGAGGAACTGCTGGCCACGA GTACGGGGTGTGGCCATGAATCCTGTGGAGCATCCTTTTGGAGGTGGCAACCACCAGCAC ATCGGCAAGCCCTCCACCATCCGCAGAGATGCCCCTGCTGGCCGCAAAGTGGGTCTCATT GCTGCCCGCCGGACTGGACGTCTCCGGGGAACCAAGACTGTGCAGGAGAAAGAGAACTAG TGCTGAGGGCCTCAATAAAGTTTGTGTTTATGCCAAAAAAAAAAAAAAAAAAAAAAAAAA AAA |
Restriction Sites | Please inquire |
ACCN | NM_000973 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000973.3, NP_000964.1 |
RefSeq Size | 903 bp |
RefSeq ORF | 774 bp |
Locus ID | 6132 |
UniProt ID | P62917 |
Cytogenetics | 8q24.3 |
Domains | Ribosomal_L2 |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L2P family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein associates with the 5.8S rRNA, very likely participates in the binding of aminoacyl-tRNA, and is a constituent of the elongation factor 2-binding site at the ribosomal subunit interface. Alternatively spliced transcript variants encoding the same protein exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the shortest transcript. Variants 1-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210653 | RPL8 (Myc-DDK-tagged)-Human ribosomal protein L8 (RPL8), transcript variant 1 |
USD 300.00 |
|
RC210653L3 | Lenti ORF clone of Human ribosomal protein L8 (RPL8), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC210653L4 | Lenti ORF clone of Human ribosomal protein L8 (RPL8), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG210653 | RPL8 (tGFP-tagged) - Human ribosomal protein L8 (RPL8), transcript variant 1 |
USD 500.00 |
|
SC119576 | RPL8 (untagged)-Human ribosomal protein L8 (RPL8), transcript variant 1 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review