CKMT2 (NM_001099735) Human Untagged Clone

CAT#: SC316744

CKMT2 (untagged)-Human creatine kinase, mitochondrial 2 (sarcomeric) (CKMT2), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_001099735" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CKMT2 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CKMT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CKMT2
Synonyms SMTCK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316744 representing NM_001099735.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGTATCTTTTCTAAGTTGCTAACTGGCCGCAATGCTTCTCTGCTGTTTGCTACCATGGGCACC
AGTGTCCTGACCACCGGGTACCTGCTGAACCGGCAGAAAGTGTGTGCCGAGGTCCGGGAGCAGCCTAGG
CTATTTCCTCCAAGCGCAGACTACCCAGACCTGCGCAAGCACAACAACTGCATGGCCGAGTGCCTCACC
CCCGCCATTTATGCCAAGCTTCGCAACAAGGTGACACCCAACGGCTACACGCTGGACCAGTGCATCCAG
ACTGGAGTGGACAACCCTGGCCACCCCTTCATAAAGACTGTGGGCATGGTGGCTGGTGACGAGGAGTCC
TATGAGGTGTTTGCTGACCTTTTTGACCCCGTCATCAAACTAAGACACAACGGCTATGACCCCAGGGTG
ATGAAGCACACAACGGATCTGGATGCATCAAAGATCACCCAAGGGCAGTTCGACGAGCATTACGTGCTG
TCTTCTCGGGTGCGCACTGGCCGCAGCATCCGTGGGCTGAGCCTGCCTCCAGCCTGCACCCGGGCCGAG
CGAAGGGAGGTAGAGAACGTGGCCATCACTGCCCTGGAGGGCCTCAAGGGGGACCTGGCTGGCCGCTAC
TACAAGCTGTCCGAGATGACGGAGCAGGACCAGCAGCGGCTCATCGATGACCACTTTCTGTTTGATAAG
CCAGTGTCCCCTTTATTAACATGTGCTGGGATGGCCCGTGACTGGCCAGATGCCAGGGGAATCTGGCAT
AATTATGATAAGACATTTCTCATCTGGATAAATGAGGAGGATCACACCAGGGTAATCTCAATGGAAAAA
GGAGGCAATATGAAACGAGTATTTGAGCGATTCTGTCGTGGACTAAAAGAAGTAGAACGGTTAATCCAA
GAACGAGGCTGGGAGTTCATGTGGAATGAGCGCCTAGGATACATTTTGACCTGTCCTTCGAACCTTGGA
ACAGGACTACGAGCTGGTGTCCACGTTAGGATCCCAAAGCTCAGCAAGGACCCACGCTTTTCTAAGATC
CTGGAAAACCTAAGACTCCAGAAGCGTGGCACAGGTGGTGTGGACACTGCCGCGGTCGCAGATGTGTAC
GACATTTCCAACATAGATAGAATTGGTCGATCAGAGGTTGAGCTTGTTCAGATAGTCATCGATGGAGTC
AATTACCTGGTGGATTGTGAAAAGAAGTTGGAGAGAGGCCAAGATATTAAGGTGCCACCCCCTCTGCCT
CAGTTTGGCAAAAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001099735
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001099735.1
RefSeq Size 1486 bp
RefSeq ORF 1260 bp
Locus ID 1160
UniProt ID P17540
Cytogenetics 5q14.1
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 47.5 kDa
Gene Summary Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.