hnRNP F (HNRNPF) (NM_001098204) Human Untagged Clone

CAT#: SC316204

HNRNPF (untagged)-Human heterogeneous nuclear ribonucleoprotein F (HNRNPF), transcript variant 2


  "NM_001098204" in other vectors (6)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
HNRNPF (hnRNP F) mouse monoclonal antibody, clone OTI5F5 (formerly 5F5)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "hnRNP F"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol hnRNP F
Synonyms HNRPF; mcs94-1; OK/SW-cl.23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316204 representing NM_001098204.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCTGGGCCCTGAGGGAGGTGAAGGCTTTGTGGTCAAGCTCCGTGGCCTGCCCTGGTCCTGCTCT
GTTGAGGACGTGCAGAACTTCCTCTCTGACTGCACGATTCATGATGGGGCCGCAGGTGTCCATTTCATC
TACACTAGAGAGGGCAGGCAGAGTGGTGAGGCTTTTGTTGAACTTGGATCAGAAGATGATGTAAAAATG
GCCCTGAAAAAAGACAGGGAAAGCATGGGACACCGGTACATTGAGGTGTTCAAGTCCCACAGAACCGAG
ATGGATTGGGTGTTGAAGCACAGTGGTCCCAACAGTGCCGACAGCGCCAACGATGGCTTCGTGCGGCTT
CGAGGACTCCCATTTGGATGCACAAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATTGTGCCA
AACGGGATCACATTGCCTGTGGACCCCGAAGGCAAGATTACAGGGGAAGCGTTCGTGCAGTTTGCCTCG
CAGGAGTTAGCTGAGAAGGCTCTAGGGAAACACAAGGAGAGGATAGGGCACAGGTACATTGAGGTGTTT
AAGAGCAGCCAGGAGGAAGTTAGGTCATACTCAGATCCCCCTCTGAAGTTCATGTCCGTGCAGCGGCCA
GGGCCCTATGACCGGCCCGGGACTGCCAGGAGGTACATTGGCATCGTGAAGCAGGCAGGCCTGGAAAGG
ATGAGGCCTGGTGCCTACAGCACAGGCTACGGGGGCTACGAGGAGTACAGTGGCCTCAGTGATGGCTAC
GGCTTCACCACCGACCTGTTCGGGAGAGACCTCAGCTACTGTCTCTCCGGAATGTATGACCACAGATAC
GGCGACAGTGAGTTCACAGTGCAGAGCACCACAGGCCACTGTGTCCACATGAGGGGCCTGCCGTACAAA
GCGACCGAGAACGACATTTACAACTTCTTCTCTCCTCTCAACCCTGTGAGAGTCCATATTGAGATTGGC
CCAGATGGAAGAGTGACGGGTGAAGCAGATGTTGAGTTTGCTACTCATGAAGAAGCTGTGGCAGCTATG
TCCAAAGACAGGGCCAATATGCAGCACAGATATATAGAACTCTTCTTGAATTCAACAACAGGGGCCAGC
AATGGGGCGTATAGCAGCCAGGTGATGCAAGGCATGGGGGTGTCTGCTGCCCAGGCCACTTACAGTGGC
CTGGAGAGCCAGTCAGTGAGTGGCTGTTACGGGGCCGGCTACAGTGGGCAGAACAGCATGGGTGGCTAT
GACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098204
Insert Size 1248 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098204.1
RefSeq Size 2650 bp
RefSeq ORF 1248 bp
Locus ID 3185
UniProt ID P52597
Cytogenetics 10q11.21
MW 45.7 kDa
Gene Summary This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs which have guanosine-rich sequences. This protein is very similar to the family member hnRPH. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1-6 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.