PAIP2B (NM_020459) Human Untagged Clone

CAT#: SC316122

PAIP2B (untagged)-Human poly(A) binding protein interacting protein 2B (PAIP2B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAIP2B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC316122 representing NM_020459.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAATGGATCCAATATGGCAAATACATCACCGAGTGTAAAATCCAAAGAGGACCAGGGGTTAAGTGGG
  CACGATGAAAAGGAAAACCCATTTGCAGAGTACATGTGGATGGAGAATGAAGAGGATTTCAACAGACAG
  GTGGAGGAGGAACTGCAGGAGCAAGACTTCTTGGACCGCTGCTTCCAAGAGATGCTGGATGAAGAAGAC
  CAAGACTGGTTTATTCCCTCACGAGACCTGCCTCAGGCCATGGGACAGTTGCAACAGCAGTTAAATGGA
  CTGTCAGTCAGTGAAGGTCATGATTCTGAAGATATTTTGAGCAAAAGTAACCTGAACCCAGATGCCAAG
  GAGTTTATTCCAGGAGAGAAGTACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_020459
• Insert Size: 372 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_020459.1
• RefSeq Size: 6300 bp
• RefSeq ORF: 372 bp
• Locus ID: 400961
• UniProt ID: Q9ULR5
• Cytogenetics: 2p13.3
• MW: 14.2 kDa
• Gene Summary: Most mRNAs, except for histones, contain a 3-prime poly(A) tail. Poly(A)-binding protein (PABP; see MIM 604679) enhances translation by circularizing mRNA through its interaction with the translation initiation factor EIF4G1 (MIM 600495) and the poly(A) tail. Various PABP-binding proteins regulate PABP activity, including PAIP1 (MIM 605184), a translational stimulator, and PAIP2A (MIM 605604) and PAIP2B, translational inhibitors (Derry et al., 2006 [PubMed 17381337]).[supplied by OMIM, Mar 2008]