Prion protein PrP (PRNP) (NM_001080121) Human Untagged Clone

CAT#: SC315705

PRNP (untagged)-Human prion protein (PRNP), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRNP
• Synonyms: AltPrP; ASCR; CD230; CJD; GSS; KURU; p27-30; PRIP; PrP; PrP27-30; PrP33-35C; PrPc
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315705 representing NM_001080121.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAG
  AAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGC
  AACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT
  GGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGA
  GGTGGCACCCACAGTCAGTGGAACAAGCCGAGTAAGCCAAAAACCAACATGAAGCACATGGCTGGTGCT
  GCAGCAGCTGGGGCAGTGGTGGGGGGCCTTGGCGGCTACATGCTGGGAAGTGCCATGAGCAGGCCCATC
  ATACATTTCGGCAGTGACTATGAGGACCGTTACTATCGTGAAAACATGCACCGTTACCCCAACCAAGTG
  TACTACAGGCCCATGGATGAGTACAGCAACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATC
  AAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAG
  CGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCG
  AGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGA
  TGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080121
• Insert Size: 762 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001080121.1
• RefSeq Size: 2750 bp
• RefSeq ORF: 762 bp
• Locus ID: 5621
• UniProt ID: P04156
• Cytogenetics: 20p13
• Protein Families: ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane
• Protein Pathways: Prion diseases
• MW: 27.7 kDa
• Gene Summary: The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-5 can all encode the same protein (Prp).