ART5 (NM_001079536) Human Untagged Clone

CAT#: SC315510

ART5 (untagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ART5
• Synonyms: ARTC5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315510 representing NM_001079536.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGCTGGCGGCTTTGATGATCGCCCTCGGCAGCCTCGGCCTCCACACCTGGCAGGCCCAGGCTGTT
  CCCATCCTGCCCCTGGGCCTGGCTCCAGACACCTTTGACGATACCTATGTGGGTTGTGCAGAGGAGATG
  GAGGAGAAGGCAGCCCCCCTGCTAAAGGAGGAAATGGCCCACCATGCCCTGCTGCGGGAATCCTGGGAG
  GCAGCCCAGGAGACCTGGGAGGACAAGCGTCGAGGGCTTACCTTGCCCCCTGGCTTCAAAGCCCAGAAT
  GGAATAGCCATTATGGTCTACACCAACTCATCGAACACCTTGTACTGGGAGTTGAATCAGGCCGTGCGG
  ACGGGCGGAGGCTCCCGGGAGCTCTACATGAGGCACTTTCCCTTCAAGGCCCTGCATTTCTACCTGATC
  CGGGCCCTGCAGCTGCTGCGAGGCAGTGGGGGCTGCAGCAGGGGACCTGGGGAGGTGGTGTTCCGAGGT
  GTGGGCAGCCTTCGCTTTGAACCCAAGAGGCTGGGAGACTCTGTCCGCTTGGGCCAGTTTGCCTCCAGC
  TCCCTGGATAAGGCAGTGGCCCACAGATTTGGTAATGCCACCCTCTTCTCTCTAACAACTTGCTTTGGG
  GCCCCTATACAGGCCTTCTCTGTCTTTCCCAAGGAGCGCGAGGTGCTGATTCCCCCCCATGAAGTCTTT
  TTGGTTACCAGATTCTCTCAGGATGGAGCCCAGAGCTTGGTGACTCTCTGGAGCTATAATCAGACCTGT
  AGCCATTTTAACTGCGCCTATCTGGGTGGGGAGAAGAGGCGGGGCTGTGTGTCTGCGCCAGGAGCCCTG
  GGAACGGGTGACCTTCATATGACGAAGAGGCACCTCCAGCAGCCTTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001079536
• Insert Size: 876 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001079536.1
• RefSeq Size: 1249 bp
• RefSeq ORF: 876 bp
• Locus ID: 116969
• UniProt ID: Q96L15
• Cytogenetics: 11p15.4
• Protein Families: Secreted Protein
• MW: 32.1 kDa
• Gene Summary: The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) contains a different 5' UTR compared to transcript variant 1. Variants 1 and 2 both encode the same isoform (a).