RCC1 (NM_001048195) Human Untagged Clone

CAT#: SC315432

RCC1 (untagged)-Human regulator of chromosome condensation 1 (RCC1), transcript variant 2


  "NM_001048195" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
RCC1 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RCC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RCC1
Synonyms CHC1; RCC1-I; SNHG3-RCC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315432 representing NM_001048195.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCACCCAAGCGCATAGCTAAAAGAAGGTCCCCCCCAGCAGATGCCATCCCCAAAAGCAAGAAGGTG
AAGGACACGAGGGCCGCTGCCTCCCGCCGCGTTCCTGGCGCCCGCTCCTGCCAAGTCTCACACAGGTCC
CACAGCACAGAACCCGGCTTGGTGCTGACACTAGGCCAGGGCGACGTGGGCCAGCTGGGGCTGGGTGAG
AATGTGATGGAGAGGAAGAAGCCGGCCCTGGTATCCATTCCGGAGGATGTTGTGCAGGCTGAGGCTGGG
GGCATGCACACCGTGTGTCTAAGCAAAAGTGGCCAGGTCTATTCCTTCGGCTGCAATGATGAGGGTGCC
CTGGGAAGGGACACATCAGTGGAGGGCTCGGAGATGGTCCCTGGGAAAGTGGAGCTGCAAGAGAAGGTG
GTACAGGTGTCAGCAGGAGACAGTCACACAGCAGCCCTCACCGATGATGGCCGTGTCTTCCTCTGGGGC
TCCTTCCGGGACAATAACGGTGTGATTGGACTGTTGGAGCCCATGAAGAAGAGCATGGTGCCTGTGCAG
GTGCAGCTGGATGTGCCTGTGGTAAAGGTGGCCTCAGGAAACGACCACTTGGTGATGCTGACAGCTGAT
GGTGACCTCTACACCTTGGGCTGCGGGGAACAGGGCCAGCTAGGCCGTGTGCCTGAGTTATTTGCCAAC
CGTGGTGGCCGGCAAGGCCTCGAACGACTCCTGGTCCCCAAGTGTGTGATGCTGAAATCCAGGGGAAGC
CGGGGCCACGTGAGATTCCAGGATGCCTTTTGTGGTGCCTATTTCACCTTTGCCATCTCCCATGAGGGC
CACGTGTACGGCTTCGGCCTCTCCAACTACCATCAGCTTGGAACTCCGGGCACAGAATCTTGCTTCATA
CCCCAGAACCTAACATCCTTCAAGAATTCCACCAAGTCCTGGGTGGGCTTCTCTGGTGGCCAGCACCAT
ACAGTCTGCATGGATTCGGAAGGAAAAGCATACAGCCTGGGCCGGGCTGAGTATGGGCGGCTGGGCCTT
GGAGAGGGTGCTGAGGAGAAGAGCATACCCACCCTCATCTCCAGGCTGCCTGCTGTCTCCTCGGTGGCT
TGTGGGGCCTCTGTGGGGTATGCTGTGACCAAGGATGGTCGTGTTTTCGCCTGGGGCATGGGCACCAAC
TACCAGCTGGGCACAGGGCAGGATGAGGACGCCTGGAGCCCTGTGGAGATGATGGGCAAACAGCTGGAG
AACCGTGTGGTCTTATCTGTGTCCAGCGGGGGCCAGCATACAGTCTTATTAGTCAAGGACAAAGAACAG
AGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001048195
Insert Size 1317 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001048195.2
RefSeq Size 2591 bp
RefSeq ORF 1317 bp
Locus ID 1104
UniProt ID P18754
Cytogenetics 1p35.3
MW 46.8 kDa
Gene Summary Guanine-nucleotide releasing factor that promotes the exchange of Ran-bound GDP by GTP, and thereby plays an important role in RAN-mediated functions in nuclear import and mitosis (PubMed:1944575, PubMed:17435751, PubMed:20668449, PubMed:22215983, PubMed:11336674). Contributes to the generation of high levels of chromosome-associated, GTP-bound RAN, which is important for mitotic spindle assembly and normal progress through mitosis (PubMed:12194828, PubMed:17435751, PubMed:22215983). Via its role in maintaining high levels of GTP-bound RAN in the nucleus, contributes to the release of cargo proteins from importins after nuclear import (PubMed:22215983). Involved in the regulation of onset of chromosome condensation in the S phase (PubMed:3678831). Binds both to the nucleosomes and double-stranded DNA (PubMed:17435751, PubMed:18762580).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.