MEIS2 (NM_170677) Human Untagged Clone

CAT#: SC313311

MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant a


  "NM_170677" in other vectors (6)

Reconstitution Protocol

USD 732.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-MEIS2 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MEIS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MEIS2
Synonyms CPCMR; HsT18361; MRG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313311 representing NM_170677.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCAAAGGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCCGCTTCCATG
TACGGAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTGAACCACGGGCCGCCGCTCCAC
GCCACACAGCACTACGGCGCGCACGCCCCGCACCCCAATGTCATGCCGGCCAGTATGGGATCCGCTGTC
AACGACGCCTTGAAGCGGGACAAGGACGCGATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTC
TTTGAGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCTGGAGTGGCTGGCGGAGACGTCTGCTCC
TCCGACTCCTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCACTTTTTTCC
TCAAATCCAGAGCTGGACAATTTGATGATACAAGCAATACAAGTACTAAGGTTTCATCTTTTGGAGTTA
GAAAAGGTCCACGAACTGTGCGATAACTTCTGCCACCGATACATTAGCTGTTTGAAGGGGAAAATGCCC
ATCGACCTCGTCATTGATGAAAGAGACGGCAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCC
ACAAATCTCGCTGACCATAACCCTTCTTCTTGGCGAGACCACGATGATGCAACCTCAACCCACTCAGCA
GGCACCCCAGGGCCCTCCAGTGGGGGCCATGCTTCCCAGAGCGGAGACAACAGCAGTGAGCAAGGGGAT
GGTTTAGACAACAGTGTAGCTTCACCTGGTACAGGTGACGATGATGATCCGGATAAGGACAAAAAACGC
CAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATATCATGAGAGCATGGCTCTTCCAGCATCTC
ACACATCCGTACCCTTCCGAAGAGCAGAAGAAACAGTTAGCGCAAGACACAGGACTTACAATTCTCCAA
GTAAACAACTGGTTTATTAATGCCAGAAGAAGAATAGTACAGCCCATGATTGACCAGTCAAATCGAGCA
GGTTTTCTTCTTGATCCTTCAGTGAGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGC
TTTGTGTTGGATGGTCAGCAACACATGGGGATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAAT
ATGGGCATGGATGGGCAATGGCACTACATGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_170677
Insert Size 1206 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170677.4
RefSeq Size 3373 bp
RefSeq ORF 1206 bp
Locus ID 4212
UniProt ID O14770
Cytogenetics 15q14
Protein Families Transcription Factors
MW 43.8 kDa
Gene Summary This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (a) represents the longest transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.