KCTD7 (NM_153033) Human Untagged Clone
CAT#: SC312818
KCTD7 (untagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1
"NM_153033" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCTD7 |
Synonyms | CLN14; EPM3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312818 representing NM_153033.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGGTAGTCACGGGGCGGGAGCCAGACAGCCGTCGTCAGGACGGTGCCATGTCCAGCTCTGACGCC GAAGACGACTTTCTGGAGCCGGCCACGCCGACGGCCACGCAGGCGGGGCACGCGCTGCCCCTGCTGCCA CAGGAGTTTCCTGAGGTTGTTCCCCTTAACATCGGAGGGGCTCACTTCACTACACGCCTGTCCACACTG CGGTGCTACGAAGACACCATGTTGGCAGCCATGTTCAGTGGGCGGCACTACATCCCCACGGACTCCGAG GGCCGGTACTTCATCGACCGAGATGGCACACACTTTGGAGATGTGCTGAATTTCCTGCGCTCAGGGGAC CTCCCACCCAGGGAGCGTGTTCGAGCTGTGTACAAAGAGGCCCAGTACTATGCCATCGGGCCCCTCCTG GAGCAGCTGGAGAACATGCAGCCACTGAAGGGCGAGAAGGTGCGCCAAGCGTTTCTGGGACTCATGCCC TATTACAAAGACCACTTGGAGCGGATTGTGGAGATCGCCCGGCTGCGTGCGGTCCAGCGGAAGGCCCGC TTTGCCAAGCTCAAGGTCTGTGTCTTCAAGGAGGAGATGCCCATCACCCCCTATGAGTGTCCGCTCCTC AACTCCCTGCGATTTGAGCGGAGTGAGAGTGACGGGCAGCTTTTTGAGCACCACTGTGAAGTGGATGTG TCTTTTGGGCCCTGGGAGGCTGTGGCTGATGTTTATGACCTGCTGCACTGCCTGGTCACGGACCTCTCG GCCCAGGGTCTCACCGTGGACCACCAGTGCATCGGGGTGTGTGACAAGCACCTCGTGAACCACTACTAC TGCAAGCGCCCCATCTATGAGTTCAAGATCACATGGTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_153033 |
Insert Size | 870 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153033.4 |
RefSeq Size | 5051 bp |
RefSeq ORF | 870 bp |
Locus ID | 154881 |
UniProt ID | Q96MP8 |
Cytogenetics | 7q11.21 |
Domains | BTB, K_tetra |
Protein Families | Ion Channels: Other |
MW | 33.1 kDa |
Gene Summary | This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221998 | KCTD7 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1 |
USD 300.00 |
|
RC221998L1 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC221998L2 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RC221998L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC221998L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG221998 | KCTD7 (tGFP-tagged) - Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review