PILRB (NM_175047) Human Untagged Clone
CAT#: SC312153
PILRB (untagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 2
"NM_175047" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PILRB |
Synonyms | FDFACT1; FDFACT2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312153 representing NM_175047.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTCGGCCCCTGCTGCTGCCCCTGCTGCTCCTGCTGCAGCCGCCAGCATTTCTGCAGCCTGGATTA TGTGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGGAGAGCGGCTTCCTCAGGATCTCAAACCTGCG GAAGGAGGACCAGTCTGTGTATTTCTGCCGAGTCGAGCTGGACACCCGGAGATCAGGGAGGCAGCAGTT GCAGTCCATCAAGGGGACCAAACTCACCATCACCCAGGCTGTCACAACCACCACCACCTGGAGGCCCAG CAGCACAACCACCATAGCCGGCCTCAGGGTCACAGAAAGCAAAGGGCACTCAGAATCATGGCACCTAAG TCTGGACACTGCCATCAGGGTTGCATTGGCTGTCGCTGTGCTCAAAACTGTCATTTTGGGACTGCTGTG CCTCCTCCTCCTGTGGTGGAGGAGAAGGAAAGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_175047 |
Insert Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175047.2 |
RefSeq Size | 2956 bp |
RefSeq ORF | 450 bp |
Locus ID | 29990 |
Cytogenetics | 7q22.1 |
Protein Families | Druggable Genome, Transmembrane |
MW | 16.4 kDa |
Gene Summary | The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate splice site in the coding region that results in a frameshift, compared to variant 1. Utilizing a common translation initiation site, the predicted isoform (b) shares identity with the N-terminal 22 aa residues of isoform a before diverging entirely. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224978 | PILRB (Myc-DDK-tagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 2 |
USD 150.00 |
|
RC224978L3 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 2, Myc-DDK-tagged |
USD 450.00 |
|
RC224978L4 | Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 2, mGFP tagged |
USD 450.00 |
|
RG224978 | PILRB (tGFP-tagged) - Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 2 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review