REC114 (NM_001042367) Human Untagged Clone

CAT#: SC311247

C15orf60 (untagged)-Human chromosome 15 open reading frame 60 (C15orf60)


  "NM_001042367" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "REC114"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol REC114
Synonyms C15orf60; CT147; OOMD10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311247 representing NM_001042367.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGGCAGGAAAAGTGCCCTTGAGCCTCGGGCTTACCGGAGGAGAAGCGGCAGAGTGGCCTCTG
CAGCGGTACGCCCGCTGCATACCCTCAAACACCAGAGACCCACCTGGGCCATGCCTGGAAGCTGGGACA
GCCCCCTGCCCCACATGGAAGGTTTTTGATTCCAATGAAGAATCTGGATATCTTGTTCTCACCATAGTT
ATATCAGGTCATTTCTTCATTTTCCAAGGACAGACACTACTGGAAGGGTTTTCACTCATTGGTAGCAAG
GACTGGTTGAAGATTGTAAGACGCGTGGATTGTCTGTTGTTTGGAACAACGATAAAGGACAAGAGTCGC
CTGTTTCGAGTACAGTTCAGTGGAGAGTCAAAGGAGCAGGCGCTGGAACACTGCTGCAGTTGTGTTCAG
AAGCTGGCACAATACATAACCGTGCAGGTGCCTGATGGAAACATCCAGGAGCTTCAGCTGATTCCTGGC
CCACCCAGGGCAACTGAAAGTCAAGGGAAGGATTCTGCAAAGAGTGTCCCACGGCAGCCTGGATCCCAC
CAGCACTCAGAACAACAGCAAGTGTGTGTAACAGCGGGCACAGGCGCTCCAGACGGAAGGACCTCACTG
ACGCAGTTAGCTCAGACTCTTCTGGCATCGGAGGAGCTGCCCCATGTCTATGAACAATCTGCATGGGGT
GCAGAAGAGTTAGGCCCCTTCCTACGTTTGTGCCTTATGGATCAGAATTTCCCAGCATTTGTGGAAGAG
GTAGAAAAGGAACTGAAAAAGCTGGCGGGTTTGAGAAATTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001042367
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042367.1
RefSeq Size 938 bp
RefSeq ORF 801 bp
Locus ID 283677
UniProt ID Q7Z4M0
Cytogenetics 15q24.1
MW 29.2 kDa
Gene Summary The protein encoded by this gene is orthologous to the mouse meiotic recombination protein REC114, which is involved in DNA double-strand break formation during meiosis. The encoded protein is conserved in most eukaryotes and was first discovered and characterized in yeast. [provided by RefSeq, Feb 2017]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.