PSMA1 (NM_148976) Human Untagged Clone

CAT#: SC306348

PSMA1 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 1


  "NM_148976" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PSMA1 mouse monoclonal antibody,clone OTI9H1
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PSMA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMA1
Synonyms HC2; HEL-S-275; NU; PROS30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306348 representing NM_148976.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCTCAGCAAGGTGAAGTTTCGAAATCAGTATGACAATGATGTCACTGTTTGGAGCCCCCAGGGC
AGGATTCATCAAATTGAATATGCAATGGAAGCTGTTAAACAAGGTTCAGCCACAGTTGGTCTGAAATCA
AAAACTCATGCAGTTTTGGTTGCATTGAAAAGGGCGCAATCAGAGCTTGCAGCTCATCAGAAAAAAATT
CTCCATGTTGACAACCATATTGGTATCTCAATTGCGGGGCTTACTGCTGATGCTAGACTGTTATGTAAT
TTTATGCGTCAGGAGTGTTTGGATTCCAGATTTGTATTCGATAGACCACTGCCTGTGTCTCGTCTTGTA
TCTCTAATTGGAAGCAAGACCCAGATACCAACACAACGATATGGCCGGAGACCATATGGTGTTGGTCTC
CTTATTGCTGGTTATGATGATATGGGCCCTCACATTTTCCAAACCTGTCCATCTGCTAACTATTTTGAC
TGCAGAGCCATGTCCATTGGAGCCCGTTCCCAATCAGCTCGTACTTACTTGGAGAGACATATGTCTGAA
TTTATGGAGTGTAATTTAAATGAACTAGTTAAACATGGTCTGCGTGCCTTAAGAGAGACGCTTCCTGCA
GAACAGGACCTGACTACAAAGAATGTTTCCATTGGAATTGTTGGTAAAGACTTGGAGTTTACAATCTAT
GATGATGATGATGTGTCTCCATTCCTGGAAGGTCTTGAAGAAAGACCACAGAGAAAGGCACAGCCTGCT
CAACCTGCTGATGAACCTGCAGAAAAGGCTGATGAACCAATGGAACATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_148976
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_148976.2
RefSeq Size 1498 bp
RefSeq ORF 810 bp
Locus ID 5682
UniProt ID P25786
Cytogenetics 11p15.2
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
MW 30.2 kDa
Gene Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Transcript Variant: This variant (1) encodes the longest isoform (1), also referred to as the long isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.