PDGF AA(PDGFA) (NM_033023) Human Untagged Clone

CAT#: SC305534

PDGFA (untagged)-Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PDGF AA(PDGFA) (NM_033023) Human Untagged Clone
Symbol PDGFA
Synonyms PDGF-A; PDGF1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033023, the custom clone sequence may differ by one or more nucleotides


ATGAGGACCTTGGCTTGCCTGCTGCTCCTCGGCTGCGGATACCTCGCCCATGTTCTGGCCGAGGAAGCCG
AGATCCCCCGCGAGGTGATCGAGAGGCTGGCCCGCAGTCAGATCCACAGCATCCGGGACCTCCAGCGACT
CCTGGAGATAGACTCCGTAGGGAGTGAGGATTCTTTGGACACCAGCCTGAGAGCTCACGGGGTCCATGCC
ACTAAGCATGTGCCCGAGAAGCGGCCCCTGCCCATTCGGAGGAAGAGAAGCATCGAGGAAGCTGTCCCCG
CTGTCTGCAAGACCAGGACGGTCATTTACGAGATTCCTCGGAGTCAGGTCGACCCCACGTCCGCCAACTT
CCTGATCTGGCCCCCGTGCGTGGAGGTGAAACGCTGCACCGGCTGCTGCAACACGAGCAGTGTCAAGTGC
CAGCCCTCCCGCGTCCACCACCGCAGCGTCAAGGTGGCCAAGGTGGAATACGTCAGGAAGAAGCCAAAAT
TAAAAGAAGTCCAGGTGAGGTTAGAGGAGCATTTGGAGTGCGCCTGCGCGACCACAAGCCTGAATCCGGA
TTATCGGGAAGAGGACACGGATGTGAGGTGA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_033023
ORF Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_033023.4, NP_148983
RefSeq Size 2740
Locus ID 5154
Cytogenetics 7p22.3
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Regulation of actin cytoskeleton, Pathways in cancer, Glioma, Prostate cancer, Melanoma
Gene Summary This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit A, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit B. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (2) lacks exon 6, compared to variant 1, and encodes the shorter isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.