HRK (NM_003806) Human Untagged Clone

CAT#: SC303381

HRK (untagged)-Human harakiri, BCL2 interacting protein (contains only BH3 domain) (HRK)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HRK
• Synonyms: DP5; HARAKIRI
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_003806 edited
  ATGTGCCCGTGCCCCCTGCACCGCGGCCGCGGCCCCCCGGCCGTGTGCGCCTGCAGCGCG
  GGTCGCCTGGGGCTGCGCTCGTCCGCCGCGCAGCTCACCGCCGCCCGGCTCAAGGCGCTA
  GGCGACGAGCTGCACCAGCGCACCATGTGGCGGCGCCGCGCGCGGAGCCGGAGGGCGCCG
  GCGCCCGGCGCGCTCCCCACCTACTGGCCTTGGCTGTGCGCGGCCGCGCAGGTGGCGGCG
  CTGGCGGCCTGGCTGCTCGGCAGGCGGAACTTGTAG
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_003806 unedited
  NGGGTTCATAATTTGTAAACGACTCACTATAGGCGGCCGCGAATCATGTGCCCGTGCCCC
  CTGCACCGCGGCCGCGGCCCCCCGGCCGTGTGCGCCTGCAGCGCGGGTCGCCTGGGGCTG
  CGCTCGTCCGCCGCGCAGCTCACCGCCGCCCGGCTCAAGGCGCTAGGCGACGAGCTGCAC
  CAGCGCACCATGTGGCGGCGCCGCGCGCGGAGCCGGAGGGCGCCGGCGCCCGGCGCGCTC
  CCCACCTACTGGCCTTGGCTGTGCGCGGCCGCGCAGGTGGCGGCGCTGGCGGCCTGGCTG
  CTCGGCAGGCGGAACTTGTAGCTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCT
  GAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAG
  TTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTG
  ACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAG
  TTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGG
  CACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCANC
  CTCCCGAGTTGTTGGGGATTCCAGGCATGCATGACCAGGCTCAACTAAATTTTGGTTTTT
  TGGTAGAGACCGGGGTTCACCATATTGGCCAAGCTGGTCCTCCACTCCTAATCTCAGGTG
  ATCTACCCACCTGGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGGCCCCTTC
  CCTGTCCTTTTGTTTTAAAAAACCACCCAGCCGGAGGACGTCCCGAACCCGATAGGGTAA
  CTG
  
• Restriction Sites: Please inquire
• ACCN: NM_003806
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_003806.1, NP_003797.1
• RefSeq Size: 716 bp
• RefSeq ORF: 276 bp
• Locus ID: 8739
• UniProt ID: O00198
• Cytogenetics: 12q24.22
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the BCL-2 protein family. Members of this family are involved in activating or inhibiting apoptosis. The encoded protein localizes to intracellular membranes. This protein promotes apoptosis by interacting with the apoptotic inhibitors BCL-2 and BCL-X(L) via its BH3 domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the protein described in PMID: 9130713 and 9228060. This transcript is supported by BF510077.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously PMID: 18008329. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.