MPST (NM_001013436) Human Untagged Clone
CAT#: SC301784
MPST (untagged)-Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_001013436" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MPST |
Synonyms | MST; TST2; TUM1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301784 representing NM_001013436.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTCGCCGCAGCTCTGCCGCGCGCTGGTGTCGGCGCAATGGGTGGCGGAGGCGCTGCGGGCCCCG CGCGCTGGGCAGCCTCTGCAGCTGCTGGACGCCTCCTGGTACCTGCCGAAGCTGGGGCGCGACGCGCGA CGCGAGTTCGAGGAGCGCCACATCCCGGGCGCCGCTTTCTTCGACATCGACCAGTGCAGCGACCGCACC TCGCCCTACGACCACATGCTGCCCGGGGCCGAGCATTTCGCGGAGTACGCAGGCCGCCTGGGCGTGGGC GCGGCCACCCACGTCGTGATCTACGACGCCAGCGACCAGGGCCTCTACTCCGCCCCGCGCGTCTGGTGG ATGTTCCGCGCCTTCGGCCACCACGCCGTGTCACTGCTTGATGGCGGCCTCCGCCACTGGCTGCGCCAG AACCTCCCGCTCAGCTCCGGCAAGAGCCAACCTGCTCCCGCCGAGTTCCGCGCTCAGCTCGACCCCGCC TTCATCAAGACCTACGAGGACATCAAGGAGAACCTGGAATCCCGGCGCTTCCAGGTGGTGGACTCCCGA GCCACTGGCAGGTTCCGCGGCACCGAGCCCGAGCCCCGAGACGGCATTGAACCTGGCCACATCCCAGGT ACCGTGAACATCCCCTTCACAGACTTCCTGAGCCAGGAGGGGCTGGAGAAGAGCCCTGAGGAGATCCGC CATCTGTTCCAGGAGAAGAAAGTGGACCTGTCTAAGCCACTGGTGGCCACGTGTGGCTCTGGCGTCACA GCCTGCCACGTGGCACTAGGGGCCTACCTCTGCGGCAAGCCAGACGTGCCCATCTACGATGGCTCCTGG GTGGAGTGGTACATGCGCGCCCGGCCCGAGGATGTCATCTCAGAGGGCCGGGGGAAGACCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013436 |
Insert Size | 894 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001013436.2 |
RefSeq Size | 1371 bp |
RefSeq ORF | 894 bp |
Locus ID | 4357 |
UniProt ID | P25325 |
Cytogenetics | 22q12.3 |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Metabolic pathways |
MW | 33.2 kDa |
Gene Summary | This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate donor splice site at the first exon compared to variant 1, resulting in translation initiation from a downstream AUG, and an isoform (2) with a shorter N-terminus compared to isoform 1. Transcript variants 2 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202466 | MPST (Myc-DDK-tagged)-Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 300.00 |
|
RC202466L1 | Lenti ORF clone of Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC202466L2 | Lenti ORF clone of Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 600.00 |
|
RC202466L3 | Lenti ORF clone of Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC202466L4 | Lenti ORF clone of Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG202466 | MPST (tGFP-tagged) - Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review