Tumor protein D52 like 3 (TPD52L3) (NM_001001875) Human Untagged Clone

CAT#: SC300324

TPD52L3 (untagged)-Human tumor protein D52-like 3 (TPD52L3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Tumor protein D52 like 3
• Synonyms: D55; hD55; NYDSP25; TPD55
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC300324 representing NM_001001875.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCACATGCCAGGACAGAGACCTCTGTGGGCACATATGAATCCCACTCGACTTCTGAACTGGAGGAT
  CTGACAGAGCCCGAGCAAAGAGAGCTCAAAACCAAACTCACTAAATTGGAGGCTGAAATTGTAACCCTA
  CGCCACGTACTAGCAGCCAAAGAGAGACGCTGTGGGGAACTCAAGAGGAAGTTAGGCCTCACCGCCTTG
  GTAGGGCTGAGACAGAATCTGTCCAAGAGCTGGCTTGATGTTCAGGTCTCCAACACCTATGTGAAACAG
  AAGACATCAGCTGCTCTGTCCACCATGGGCACTCTCATCTGCAGGAAGCTTGGAGGCGTGAAGAAGTCG
  GCCACACTCAGATCTTTTGAAGGAAACCCTAAAGGAGAAGGAAGCAGAATATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001001875
• Insert Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001001875.3
• RefSeq Size: 1353 bp
• RefSeq ORF: 399 bp
• Locus ID: 89882
• UniProt ID: Q96J77
• Cytogenetics: 9p24.1
• Protein Families: Druggable Genome
• MW: 14.6 kDa
• Gene Summary: This gene encodes a member of the tumor protein D52-like family of proteins. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. The encoded protein may play a role in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (3) lacks an internal segment, as compared to variant 1. It encodes isoform 3 which has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.