FARP1 (NM_001001715) Human Untagged Clone

CAT#: SC300297

FARP1 (untagged)-Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2


  "NM_001001715" in other vectors (4)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


FARP1 Antibody - middle region
    • 100 ul

USD 539.00

Other products for "FARP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FARP1
Synonyms CDEP; FARP1-IT1; PLEKHC2; PPP1R75
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300297 representing NM_001001715.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGAAATAGAGCAGAGGCCGACCCCAGGATCACGACTGGGGGCCCCGGAAAATTCGGGGATCAGT
ACCTTGGAACGTGGACAGAAGCCGCCCCCAACACCTTCAGGAAAACTCGTGTCCATCAAAATCCAGATG
CTGGATGACACCCAGGAGGCATTTGAAGTTCCAATGGTGTCCTCATCCTCCTTCCTCAAAGCCACCGGC
TCCTCCTGGACGGGTTGGGTACTGAGATGCTCCATGAAGCCCAAGCACCATTCACATCTAATTGAGAAG
TTTGGAGAGGACAGAATTCTCACTCATCTTACAGGCTCTATTTCTTACACAAACTGGGCTGGAAGTAGA
AGCTTAGCGGTCACAGTCACTGAAGAGCTTCTTAATCTTTTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001001715
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001715.3
RefSeq Size 1419 bp
RefSeq ORF 390 bp
Locus ID 10160
UniProt ID Q9Y4F1
Cytogenetics 13q32.2
MW 14.1 kDa
Gene Summary This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) lacks multiple 3' coding exons and contains an alternate 3' terminal exon, which results in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.