FARP1 (NM_001001715) Human Untagged Clone
CAT#: SC300297
FARP1 (untagged)-Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2
"NM_001001715" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FARP1 |
Synonyms | CDEP; FARP1-IT1; PLEKHC2; PPP1R75 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300297 representing NM_001001715.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAGAAATAGAGCAGAGGCCGACCCCAGGATCACGACTGGGGGCCCCGGAAAATTCGGGGATCAGT ACCTTGGAACGTGGACAGAAGCCGCCCCCAACACCTTCAGGAAAACTCGTGTCCATCAAAATCCAGATG CTGGATGACACCCAGGAGGCATTTGAAGTTCCAATGGTGTCCTCATCCTCCTTCCTCAAAGCCACCGGC TCCTCCTGGACGGGTTGGGTACTGAGATGCTCCATGAAGCCCAAGCACCATTCACATCTAATTGAGAAG TTTGGAGAGGACAGAATTCTCACTCATCTTACAGGCTCTATTTCTTACACAAACTGGGCTGGAAGTAGA AGCTTAGCGGTCACAGTCACTGAAGAGCTTCTTAATCTTTTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001715 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001715.3 |
RefSeq Size | 1419 bp |
RefSeq ORF | 390 bp |
Locus ID | 10160 |
UniProt ID | Q9Y4F1 |
Cytogenetics | 13q32.2 |
MW | 14.1 kDa |
Gene Summary | This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (2) lacks multiple 3' coding exons and contains an alternate 3' terminal exon, which results in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220519 | FARP1 (Myc-DDK-tagged)-Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2 |
USD 150.00 |
|
RC220519L3 | Lenti ORF clone of Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2, Myc-DDK-tagged |
USD 450.00 |
|
RC220519L4 | Lenti ORF clone of Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2, mGFP tagged |
USD 450.00 |
|
RG220519 | FARP1 (tGFP-tagged) - Human FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (FARP1), transcript variant 2 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review