GDPD2 (NM_017711) Human Untagged Clone

CAT#: SC126346

Reviews ()
Write a review

GDPD2 (untagged)-Human glycerophosphodiester phosphodiesterase domain containing 2 (GDPD2), transcript variant 2


Product Datasheet for 'SC126346'


  "NM_017711" in other vectors (4)

Need a mutant or fragment? Switch to a different vector? Get a free quote.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name GDPD2 (NM_017711) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol GDPD2
Synonyms GDE3; OBDPF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_017711 edited
GGGAAGCAGTGCAGAGAGGAGAGCGGAGCGGAGCTGCCGCTGAGCAAAGGCCTTCACCAT
GGCCGAGTCCCCCGGCTGCTGCTCCGTCTGGGCCCGCTGCCTCCACTGCCTGTATAGCTG
CCACTGGAGGAAATGCCCCAGAGAGAGGATGCAAACCAGCAAGTGCGACTGTATCTGGTT
TGGCCTGCTCTTCCTCACCTTCCTCCTTTCCCTGAGCTGGCTGTACATCGGGCTCGTCCT
TCTCAATGACCTGCACAACTTCAATGAATTCCTCTTCCGCCGCTGGGGACACTGGATGGA
CTGGTCCCTGGCATTCCTGCTGGTCATCTCTCTACTGGTCACATATGCATCCTTGCTATT
GGTCCTGGCCCTGCTCCTGCGGCTTTGTAGACAGCCCCTGCATCTGCACAGCCTCCACAA
GGTGCTGCTGCTCCTCATTATGCTGCTTGTGGCGGCTGGCCTTGTGGGACTGGACATCCA
ATGGCAGCAGGAGTGGCATAGCTTGCGTGTGTCACTGCAGGCCACAGCCCCATTCCTTCA
TATTGGAGCAGCCGCTGGAATTGCCCTCCTGGCCTGGCCTGTGGCTGATACCTTCTACCG
TATCCACCGAAGAGGTCCCAAGATTCTGCTACTGCTCCTATTTTTTGGAGTTGTCCTGGT
CATCTACTTGGCCCCCCTATGCATCTCCTCACCCTGCATCATGGAACCCAGAGACTTACC
ACCCAAGCCTGGGCTGGTGGGACACCGAGGGGCCCCCATGCTGGCTCCCGAGAACACCCT
GATGTCCTTGCGGAAGACAGCTGAATGCGGAGCTACTGTGTTTGAGACTGATGTGATGGT
CAGCTCCGATGGGGTCCCCTTCCTCATGCATGATGAGCACCTCAGCAGGACCACGAATGT
AGCCTCTGTATTCCCAACCCGAATCACAGCCCACAGCAGTGACTTCTCCTGGACTGAACT
GAAGAGACTCAATGCTGGATCCTGGTTCCTAGAGAGGCGACCCTTCTGGGGGGCCAAACC
GCTGGCAGGCCCTGATCAGAAAGAGGCTGAGAGTCAGACGGTACCAGCATTAGAAGAGCT
ATTGGAGGAAGCTGCAGCCCTCAACCTTTCCATCATGTTCGACTTGCGCCGACCCCCACA
GAACCACACATACTATGACACTTTTGTGATCCAGACATTGGAGACTGTGCTGAATGCAAG
GGTGCCCCAAGCCATGGTCTTTTGGCTACCAGATGAAGATCGGGCTAATGTCCAACGACG
GGCACCTGGAATGCGCCAGATATATGGACGTCAGGGAGGCAACAGAACGGAGAGGCCCCA
GTTTCTTAACCTCCCCTATCAAGATCTGCCACTATTGGATATCAAGGCATTGCATAAGGA
TAATGTCTCGGTGAACCTATTTGTAGTGAACAAGCCCTGGCTCTTCTCTCTGCTTTGGTG
TGCAGGGGTGGATTCGGTCACCACCAACGACTGCCAGCTGCTGCAGCAGATGCGTTACCC
TATCTGGCTTATTACCCCTCAAACCTACCTAATCATATGGGTCATTACCAATTGTGTTTC
CACCATGCTGCTTTTGTGGACCTTCCTCCTCCAAAGGAGATTTGTTAAGAAGAGAGGGAA
AACTGGCTTAGAAACAGCAGTGCTGCTGACAAGGATCAACAATTTCATGATGGAGTGAAT
GCCCTGCCCTGCTTCCCCACCCAAGCCAGTCTACATTGCCCAAACAGCAAGGGTTGGAGA
GTGGCTTAAGTGGAATGCTTCAGGGGTGGTGGGTTGCAAGTGGGGGGAGCTTTGCCAACA
GGAGGTTTTGAACCATGAGGGCCCTCTGCCCAGGTGATGGGCATTCCCTAAGCTGCTATG
GAATCTGCTCCCTTTGGGGTTTTGACCTGAGATGTTTGGGAAGAGAGTGAGTAATGAGAA
GTTTCTCCTCAAATGAAACTAGAACAGAGGAAGTAAAAGGGAGATTGCTCGGAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_017711 unedited
GTTCAGTATATTTGTCAATACGCACCCACTGATAGGGCGGACCGCGTAATTCAGTTGCTG
GCTACCGGCTCCGGTAATTCCCGGGATGGGAAGCAGTGCAGAGAGGAGAGCGGAGCGGAG
CTGCCGCTGAGCAAAGGCCTTCACCATGGCCGAGTCCCCCGGCTGCTGCTCCGTCTGGGC
CCGCTGCCTCCACTGCCTGTATAGCTGCCACTGGAGGAAATGCCCCAGAGAGAGGATGCA
AACCAGCAAGTGCGACTGTATCTGGTTTGGCCTGCTCTTCCTCACCTTCCTCCTTTCCCT
GAGCTGGCTGTACATCGGGCTCGTCCTTCTCAATGACCTGCACAACTTCAATGAATTCCT
CTTCCGCCGCTGGGGACACTGGATGGACTGGTCCCTGGCATTCCTGCTGGTCATCTCTCT
ACTGGTCACATATGCATCCTTGCTATTGGTCCTGGCCCTGCTCCTGCGGCTTTGTAGACA
GCCCCTGCATCTGCACAGCCTCCACAAGGTGCTGCTGCTCCTCATTATGCTGCTTGTGGC
GGCTGGCCTTGTGGGACTGGACATCCAATGGCAGCAGGAGTGGCATAGCTTGCGTGTGTC
ACTGCAGGCCACAGCCCCATTCCTTCATATTGGAGCAGCCGCTGGAATTGCCCTCCTGGC
CTGGCCTGTGGCTGATACCTTCTACCGTATCCACCGAAGAGGTCCCAAGATTCTGCTACT
GCTCCTATTTTTTGGAGTTGTCCTGGTCATCTACTTGGCCCCCCTATGCATCCTCTCACC
CTGCATCATGGAACCCAGAGACTTACCACCCAACCCTGGGCTGGTGGGACACCGAGGGGC
CCCCATGCTGGCTCCCGAAACACCCTGATGTCCTTGCGGAAAAAACCTGAATGCGGAACT
ACTGGGTTGAGAACTGAGTGATGGTCAGCTCCCAGGGGGCCCCC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_017711
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_017711.2, NP_060181.2
RefSeq Size 2199 bp
RefSeq ORF 1620 bp
Locus ID 54857
Cytogenetics Xq13.1
Protein Families Transmembrane
Gene Summary This gene encodes a member of the glycerophosphodiester phosphodiesterase enzyme family. The encoded protein hydrolyzes glycerophosphoinositol to produce inositol 1-phosphate and glycerol. This protein may have a role in osteoblast differentiation and growth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.

Other Versions

Other products for "GDPD2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools