Presenilin 1(PSEN1) (NM_000021) Human Untagged Clone

CAT#: SC125532

PSEN1 (untagged)-Human presenilin 1 (PSEN1), transcript variant 1

USD 742


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Presenilin 1(PSEN1) (NM_000021) Human Untagged Clone
Symbol PSEN1
Synonyms AD3; FAD; PS-1; PS1; S182
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125532 sequence for NM_000021 edited (data generated by NextGen Sequencing)
ATGACAGAGTTACCTGCACCGTTGTCCTACTTCCAGAATGCACAGATGTCTGAGGACAAC
CACCTGAGCAATACTGTACGTAGCCAGAATGACAATAGAGAACGGCAGGAGCACAACGAC
AGACGGAGCCTTGGCCACCCTGAGCCATTATCTAATGGACGACCCCAGGGTAACTCCCGG
CAGGTGGTGGAGCAAGATGAGGAAGAAGATGAGGAGCTGACATTGAAATATGGCGCCAAG
CATGTGATCATGCTCTTTGTCCCTGTGACTCTCTGCATGGTGGTGGTCGTGGCTACCATT
AAGTCAGTCAGCTTTTATACCCGGAAGGATGGGCAGCTAATCTATACCCCATTCACAGAA
GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC
AGTGTCATTGTTGTCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAG
GTCATCCATGCCTGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATT
TACTTGGGGGAAGTGTTTAAAACCTATAACGTTGCTGTGGACTACATTACTGTTGCACTC
CTGATCTGGAATTTTGGTGTGGTGGGAATGATTTCCATTCACTGGAAAGGTCCACTTCGA
CTCCAGCAGGCATATCTCATTATGATTAGTGCCCTCATGGCCCTGGTGTTTATCAAGTAC
CTCCCTGAATGGACTGCGTGGCTCATCTTGGCTGTGATTTCAGTATATGATTTAGTGGCT
GTTTTGTGTCCGAAAGGTCCACTTCGTATGCTGGTTGAAACAGCTCAGGAGAGAAATGAA
ACGCTTTTTCCAGCTCTCATTTACTCCTCAACAATGGTGTGGTTGGTGAATATGGCAGAA
GGAGACCCGGAAGCTCAAAGGAGAGTATCCAAAAATTCCAAGTATAATGCAGAAAGCACA
GAAAGGGAGTCACAAGACACTGTTGCAGAGAATGATGATGGCGGGTTCAGTGAGGAATGG
GAAGCCCAGAGGGACAGTCATCTAGGGCCTCATCGCTCTACACCTGAGTCACGAGCTGCT
GTCCAGGAACTTTCCAGCAGTATCCTCGCTGGTGAAGACCCAGAGGAAAGGGGAGTAAAA
CTTGGATTGGGAGATTTCATTTTCTACAGTGTTCTGGTTGGTAAAGCCTCAGCAACAGCC
AGTGGAGACTGGAACACAACCATAGCCTGTTTCGTAGCCATATTAATTGGTTTGTGCCTT
ACATTATTACTCCTTGCCATTTTCAAGAAAGCATTGCCAGCTCTTCCAATCTCCATCACC
TTTGGGCTTGTTTTCTACTTTGCCACAGATTATCTTGTACAGCCTTTTATGGACCAATTA
GCATTCCATCAATTTTATATCTAG

Clone variation with respect to NM_000021.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007318 unedited
TAACGTTATATATTGTAATACACTCATATAGGCGGCCGCGAACTCGGCACGAGGGAGCTA
CGAGCCGCGGCGGCAGCGGGGCGGCGGGGAAGCGTATACCTAATCTGGGAGCCTGCAAGT
GACAACAGCCTTTGCGGTCCTTAGACAGCTTGGCCTGGAGGAGAACACATGAAAGAAAGA
ACCTCAAGAGGCTTTGTTTTCTGTGAAACAGTATTTCTATACAGTTGCTCCAATGACAGA
GTTACCTGCACCGTTGTCCTACTTCCAGAATGCACAGATGTCTGAGGACAACCACCTGAG
CAATACTGTACGTAGCCAGAATGACAATAGAGAACGGCAGGAGCACAACGACAGACGGAG
CCTTGGCCACCCTGAGCCATTATCTAATGGACGACCCCAGGGTAACTCCCGGCAGGTGGT
GGAGCAAGATGAGGAAGAAGATGAGGAGCTGACATTGAAATATGGCGCCAAGCATGTGAT
CATGCTCTTTGTCCCTGTGACTCTCTGCATGGTGGTGGTCGTGGCTACCATTAAGTCAGT
CAGCTTTTATACCCGGAAGGATGGGCAGCTAATCTATACCCCATTCACAGAAGATACCGA
GACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATCAGTGTCAT
TGTTGTCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAAGTCATCCA
TGCCTGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATTTACTTGGN
GGGAAGTGTTTAANACCTATAACGTTGCTGTGGACTACATTACTGTTGCACTCCTGATCT
GAATTNNTGTGTAGTGGGGAATGATTTCCATTACTGGNAAGGGTCATTNCGACTNCAGCA
GGCATATCTCATTATGATTAGTGCCCTCATGGCCCCTGGTGTTTATCAAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007318 unedited
GGGGGGTGTGTGGTNTTATNTTTCTCTTTCTACCAAAAGGGNTTCGCGGACCTTTTAACT
CCTTTTTTAAATCTACCGTCTTTGGGCATACATCTCATTTGCTGTGGAAGAAGTCTGACA
GCAGGGCTGACAGCACCGATTCATAACACATTCTTTTCATCATACAAAGAGTAAGACCCT
AGAATAATGGGACCATCTGCTACCACGACAGAGCTGCCTTACTGGCTGTAGAAAAAGACT
GCTTGTGTGGGAGAGAAGAATGAGGACAGAGGAGGCATCTGGGGCAAGTGAGCGTACAAG
TATGTCTACAAATTCAGAATTTGGTGGAAAATCCAAATTTGACTTCAACATGATAGAGAA
TTGATGAGAAATAGCTGTACTGTTTCCAAAATTTACTGAATTTGGAACCTGAGGTTAAAA
CTTTTAGGATAAAGCAACCTCAGGTTCAGACTGGCCTTGGGAAGAAATGGCAATCACAGA
CGGTAATGAGTGTCAGTGCTTGAGAAGAAGAATTGCCAAAGGCAATCTACATATTTGACT
TGACTCAAAGAGAGGGGAAAACAAGTCTCATTTAAAAAGGATGAGTCTGCAGCAAAAAAT
CAAAGGGAAGCTGGAACCCCTGCCCACCTCTCCATTCCCCATTCTGCTGCTGGTGCCTGC
TCTTCCTCACAGTACCTCCTGAAAAGTTCACAATTCAGTTAATACAGAATTATTGGGTTG
ATTTTCAACGTGTAGTTTAAGATGAAGAGTTCCGTTTGGTTAAAACCACTTACCTAACCT
CTTGGAACCGTAGTCCTGAGAGTTCCCACGGCAGTGAAATCGTCCTGTGACCACCCGTCA
AGCTGCTGATGGGGCACAACAACTTCCGGGGCCTATAATATTTCCCTTGACCTCGTCCCT
CAAATCTGGGCGATTCTG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000021
ORF Size 1404 bp
Insert Size 2700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000021.2, NP_000012
RefSeq Size 2763
RefSeq ORF 1404
Locus ID 5663
Cytogenetics 14q24.2
Domains Presenilin, PSN
Protein Families Transmembrane, Protease, Druggable Genome
Protein Pathways Wnt signaling pathway, Notch signaling pathway, Neurotrophin signaling pathway, Alzheimer's disease
Gene Summary Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008].
Transcript Variant: This variant (1) encodes the longer isoform (I-467).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations