Presenilin 1 (PSEN1) (NM_000021) Human Untagged Clone

CAT#: SC125532

PSEN1 (untagged)-Human presenilin 1 (PSEN1), transcript variant 1


  "NM_000021" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PSEN1 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Presenilin 1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Presenilin 1
Synonyms ACNINV3; AD3; FAD; PS-1; PS1; S182
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC125532 sequence for NM_000021 edited (data generated by NextGen Sequencing)
ATGACAGAGTTACCTGCACCGTTGTCCTACTTCCAGAATGCACAGATGTCTGAGGACAAC
CACCTGAGCAATACTGTACGTAGCCAGAATGACAATAGAGAACGGCAGGAGCACAACGAC
AGACGGAGCCTTGGCCACCCTGAGCCATTATCTAATGGACGACCCCAGGGTAACTCCCGG
CAGGTGGTGGAGCAAGATGAGGAAGAAGATGAGGAGCTGACATTGAAATATGGCGCCAAG
CATGTGATCATGCTCTTTGTCCCTGTGACTCTCTGCATGGTGGTGGTCGTGGCTACCATT
AAGTCAGTCAGCTTTTATACCCGGAAGGATGGGCAGCTAATCTATACCCCATTCACAGAA
GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC
AGTGTCATTGTTGTCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAG
GTCATCCATGCCTGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATT
TACTTGGGGGAAGTGTTTAAAACCTATAACGTTGCTGTGGACTACATTACTGTTGCACTC
CTGATCTGGAATTTTGGTGTGGTGGGAATGATTTCCATTCACTGGAAAGGTCCACTTCGA
CTCCAGCAGGCATATCTCATTATGATTAGTGCCCTCATGGCCCTGGTGTTTATCAAGTAC
CTCCCTGAATGGACTGCGTGGCTCATCTTGGCTGTGATTTCAGTATATGATTTAGTGGCT
GTTTTGTGTCCGAAAGGTCCACTTCGTATGCTGGTTGAAACAGCTCAGGAGAGAAATGAA
ACGCTTTTTCCAGCTCTCATTTACTCCTCAACAATGGTGTGGTTGGTGAATATGGCAGAA
GGAGACCCGGAAGCTCAAAGGAGAGTATCCAAAAATTCCAAGTATAATGCAGAAAGCACA
GAAAGGGAGTCACAAGACACTGTTGCAGAGAATGATGATGGCGGGTTCAGTGAGGAATGG
GAAGCCCAGAGGGACAGTCATCTAGGGCCTCATCGCTCTACACCTGAGTCACGAGCTGCT
GTCCAGGAACTTTCCAGCAGTATCCTCGCTGGTGAAGACCCAGAGGAAAGGGGAGTAAAA
CTTGGATTGGGAGATTTCATTTTCTACAGTGTTCTGGTTGGTAAAGCCTCAGCAACAGCC
AGTGGAGACTGGAACACAACCATAGCCTGTTTCGTAGCCATATTAATTGGTTTGTGCCTT
ACATTATTACTCCTTGCCATTTTCAAGAAAGCATTGCCAGCTCTTCCAATCTCCATCACC
TTTGGGCTTGTTTTCTACTTTGCCACAGATTATCTTGTACAGCCTTTTATGGACCAATTA
GCATTCCATCAATTTTATATCTAG

Clone variation with respect to NM_000021.3
Restriction Sites NotI-NotI     
ACCN NM_000021
Insert Size 1404 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000021.2, NP_000012.1
RefSeq Size 2763 bp
RefSeq ORF 1404 bp
Locus ID 5663
UniProt ID P49768
Cytogenetics 14q24.2
Domains Presenilin, PSN
Protein Families Druggable Genome, Protease, Transmembrane
Protein Pathways Alzheimer's disease, Neurotrophin signaling pathway, Notch signaling pathway, Wnt signaling pathway
Gene Summary Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) encodes the longer isoform (I-467).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.