GGT1 (NM_005265) Human Untagged Clone

CAT#: SC125422

GGT1 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human gamma-glutamyltransferase 1 (GGT1),

USD 299


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GGT1 (NM_005265) Human Untagged Clone
Symbol GGT1
Synonyms CD224; D22S672; D22S732; GGT; GGT 1; GTG
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005265, the custom clone sequence may differ by one or more nucleotides


ATGAAGAAGAAGTTAGTGGTGCTGGGCCTGCTGGCCGTGGTCCTGGTGCTGGTCATTGTCGGCCTCTGTC
TCTGGCTGCCCTCAGCCTCCAAGGAACCTGACAACCATGTGTACACCAGGGCTGCCGTGGCCGCGGATGC
CAAGCAGTGCTCGAAGATTGGGAGGGATGCACTGCGGGACGGTGGCTCTGCGGTGGATGCAGCCATTGCA
GCCCTGTTGTGTGTGGGGCTCATGAATGCCCACAGCATGGGCATCGGGGGTGGCCTCTTCCTCACCATCT
ACAACAGCACCACACGAAAAGCTGAGGTCATCAACGCCCGCGAGGTGGCCCCCAGGCTGGCCTTTGCCAC
CATGTTCAACAGCTCGGAGCAGTCCCAGAAGGGGGGGCTGTCGGTGGCGGTGCCTGGGGAGATCCGAGGC
TATGAGCTGGCACACCAGCGGCATGGGCGGCTGCCCTGGGCTCGCCTCTTCCAGCCCAGCATCCAGCTGG
CCCGCCAGGGCTTCCCCGTGGGCAAGGGCTTGGCGGCAGCCCTGGAAAACAAGCGGACCGTCATCGAGCA
GCAGCCTGTCTTGTGTGAGGTGTTCTGCCGGGATAGAAAGGTGCTTCGGGAGGGGGAGAGACTGACCCTG
CCGCAGCTGGCTGACACCTACGAGACGCTGGCCATCGAGGGTGCCCAGGCCTTCTACAACGGCAGCCTCA
CGGCCCAGATTGTGAAGGACATCCAGGCGGCCGGGGGCATTGTGACAGCTGAGGACCTGAACAACTACCG
TGCTGAGCTGATCGAGCACCCGCTGAACATCAGCCTGGGAGACGTGGTGCTGTACATGCCCAGTGCGCCG
CTCAGCGGGCCCGTGCTGGCCCTCATCCTCAACATCCTCAAAGGGTACAACTTCTCCCGGGAGAGCGTGG
AGAGCCCCGAGCAGAAGGGCCTGACGTACCACCGCATCGTAGAGGCTTTCCGGTTTGCCTACGCCAAGAG
GACCCTGCTTGGGGACCCCAAGTTTGTGGATGTGACTGAGGTGGTCCGCAACATGACCTCCGAGTTCTTC
GCTGCCCAGCTCCGGGCCCAGATCTCTGACGACACCACTCACCCGATCTCCTACTACAAGCCCGAGTTCT
ACACGCCGGATGACGGGGGCACTGCTCACCTGTCTGTCGTCGCAGAGGACGGCAGTGCTGTGTCCGCCAC
CAGCACCATCAACCTCTACTTTGGCTCCAAGGTCCGCTCCCCGGTCAGCGGGATCCTGTTCAATAATGAA
ATGGACGACTTCAGCTCTCCCAGCATCACCAACGAGTTTGGGGTACCCCCCTCACCTGCCAATTTCATCC
AGCCAGGGAAGCAGCCGCTCTCGTCCATGTGCCCGACGATCATGGTGGGCCAGGACGGCCAGGTCCGGAT
GGTGGTGGGAGCTGCTGGGGGCACACAGATCACCACGGCCACTGCACTGGCCATCATCTACAACCTCTGG
TTCGGCTATGACGTGAAGCGGGCCGTGGAGGAGCCCCGGCTGCACAACCAGCTTCTGCCCAACGTCACGA
CAGTGGAGAGAAACATTGACCAGGCAGTGACTGCAGCCCTGGAGACCCGGCACCATCACACCCAGATCGC
GTCCACCTTCATCGCTGTGGTGCAAGCCATCGTCCGCACGGCTGGTGGCTGGGCAGCTGCCTCGGACTCC
AGGAAAGGCGGGGAGCCTGCCGGCTACTGA


3' Read Nucleotide Sequence
>OriGene 3' read for NM_005265 unedited
TCCAGGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATCTGTTCAG
GAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACAGGCCAGGGAGGCCA
CCTGGAGCCTGGCACAATGGCCCCATTTATTGGGCTGCTCTGCTGCTCAAAAGGGAAACC
GGTCCCCCAAAATCCCCTTTCTGGGCCTGGGGAGTATTTTGTCCCTGGATTGGTTGTCAA
CCTTGTCCTCCTGGAACACTCAATAACCGGGAGGCTCCCCGCCTTTTCTGGAGTCCGAGG
GAATTTCCCAACCACCAACCGTGCGGACAATGGGTTGGACCAAAACGATTAAAGGGGACC
CCATCTGGGTGTGATGGTGCCCGGTCTCCAAGGGTGCAATCACTGCCTGGTGAAAGTTTC
TTTCCACTGTCCTGACCTTGGGCAAAAACTGGTTGTGCAACCGGGGCTTCTTCACGGGCC
GCTTTACGTTATAACCCAACCAAAAGTTGTAAAATTATGGGCAATGCAATGGCCCGTGGT
GATTTGTGTGCCCCCCAAAACTTCCAACAACATTCGGACCTGGGCGTTCTGGGCCACCAA
TATTTTTGGGCAAATGGACAAAAGCGGGTGCTTTCCTGGGTGGATAAAATTGGGAGGGGA
GGGGGGGTCCCCCAACTCTTTGGTGATCGTG
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_005265
ORF Size 1710 bp
Insert Size 1710
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005265.2, NP_005256
RefSeq Size 2431
RefSeq ORF 1710
Locus ID 2678
Cytogenetics 22q11.23
Domains G_glu_transpept
Protein Families Transmembrane, Protease
Protein Pathways Taurine and hypotaurine metabolism, Selenoamino acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Arachidonic acid metabolism, Metabolic pathways
Gene Summary The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.