FIGF (NM_004469) Human Untagged Clone

CAT#: SC122680

FIGF (untagged)-Human c-fos induced growth factor (vascular endothelial growth factor D) (FIGF)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FIGF (NM_004469) Human Untagged Clone
Symbol FIGF
Synonyms VEGF-D; VEGFD
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004469 edited
CAAAAAAGTTTCAATCCAGAGTTGGGTTCCAGCTTTCTGTAGCTGTAAGCATTGGTGGCC
ACACCACCTCCTTACAAAGCAACTAGAACCTGCGGCATACGTTGGAGAGATTTTTTTAAT
TTTCTGGACATGAAGTAAATTTAGAGTGCTTTCTAATTTCAGGTAGAAGACATGTCCACC
TTCTGATTATTTTTGGAGCATGAGAACATTTTGATTTTTTTCATCTCTCTCTCCCCACCC
CTAAGATTGTGCAAAAAAAGCGTACCTTGCCTAATTGAAATAATTTCATTGGATTTTGAT
CAGAACTGATTATTTGGTTTTCTGTGTGAAGTTTTGAGGTTTCAAACTTTCCTTCTGGAG
AATGCCTTTTGAAACAATTTTCTCTAGCTGCCTGATGTCAACTGCTTAGTAATCAGTGGA
TATTGAAATATTCAAAATGTACAGAGAGTGGGTAGTGGTGAATGTTTTCATGATGTTGTA
CGTCCAGCTGGTGCAGGGCTCCAGTAATGAACATGGACCAGTGAAGCGATCATCTCAGTC
CACATTGGAACGATCTGAACAGCAGATCAGGGCTGCTTCTAGTTTGGAGGAACTACTTCG
AATTACTCACTCTGAGGACTGGAAGCTGTGGAGATGCAGGCTGAGGCTCAAAAGTTTTAC
CAGTATGGACTCTCGCTCAGCATCCCATCGGTCCACTAGGTTTGCGGCAACTTTCTATGA
CATTGAAACACTAAAAGTTATAGATGAAGAATGGCAAAGAACTCAGTGCAGCCCTAGAGA
AACGTGCGTGGAGGTGGCCAGTGAGCTGGGGAAGAGTACCAACACATTCTTCAAGCCCCC
TTGTGTGAACGTGTTCCGATGTGGTGGCTGTTGCAATGAAGAGAGCCTTATCTGTATGAA
CACCAGCACCTCGTACATTTCCAAACAGCTCTTTGAGATATCAGTGCCTTTGACATCAGT
ACCTGAATTAGTGCCTGTTAAAGTTGCCAATCATACAGGTTGTAAGTGCTTGCCAACAGC
CCCCCGCCATCCATACTCAATTATCAGAAGATCCATCCAGATCCCTGAAGAAGATCGCTG
TTCCCATTCCAAGAAACTCTGTCCTATTGACATGCTATGGGATAGCAACAAATGTAAATG
TGTTTTGCAGGAGGAAAATCCACTTGCTGGAACAGAAGACCACTCTCATCTCCAGGAACC
AGCTCTCTGTGGGCCACACATGATGTTTGACGAAGATCGTTGCGAGTGTGTCTGTAAAAC
ACCATGTCCCAAAGATCTAATCCAGCACCCCAAAAACTGCAGTTGCTTTGAGTGCAAAGA
AAGTCTGGAGACCTGCTGCCAGAAGCACAAGCTATTTCACCCAGACACCTGCAGCTGTGA
GGACAGATGCCCCTTTCATACCAGACCATGTGCAAGTGGCAAAACAGCATGTGCAAAGCA
TTGCCGCTTTCCAAAGGAGAAAAGGGCTGCCCAGGGGCCCCACAGCCGAAAGAATCCTTG
ATTCAGCGTTCCAAGTTCCCCATCCCTGTCATTTTTAACAGCATGCTGCTTTGCCAAGTT
GCTGTCACTGTTTTTTTCCCAGGTGTTAAAAAAAAAAATCCATTTTACACAGCACCACAG
TGAATCCAGACCAACCTTCCATTCACACCAGCTAAGGAGTCCCTGGTTCATTGATGGATG
TCTTCTAGCTGCAGATGCCTCTGCGCACCAAGGAATGGAGAGGAGGGGACCCATGTAATC
CTTTTGTTTAGTTTTGTTTTTGTTTTTTGGTGAATGAGAAAGGTGTGCTGGTCATGGAAT
GGCAGGTGTCATATGACTGATTACTCAGAGCAGATGAGGAAAACTGTAGTCTCTGAGTCC
TTTGCTAATCGCAACTCTTGTGAATTATTCTGATTCTTTTTTATGCAGAATTTGATTCGT
ATGATCAGTACTGACTTTCTGATTACTGTCCAGCTTATAGTCTTCCAGTTTAATGAACTA
CCATCTGATGTTTCATATTTAAGTGTATTTAAAGAAAATAAACACCATTATTCAAGCCAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004469 unedited
GCTCTTGTTTTGTAATACGACTTACTATTAGTGGCGGCCGCGATTCCCGGGATCAAAAAA
TTTCAATCCAGAGTTGGGTTCCAGCTTTCTGTAGCTGTAAGCATTGGTGGCCACACCACC
TCCTTACAAAGCAACTAGAACCTGCGGCATACGTTGGAGAGATTTTTTTAATTTTCTGGA
CATGAAGTAAATTTAGAGTGCTTTCTAATTTCAGGTAGAAGACATGTCCACCTTCTGATT
ATTTTTGGAGCATGAGAACATTTTGATTTTTTTCATCTCTCTCTCCCCACCCCTAAGATT
GTGCAAAAAAAGCGTACCTTGCCTAATTGAAATAATTTCATTGGATTTTGATCAGAACTG
ATTATTTGGTTTTCTGTGTGAAGTTTTGAGGTTTCAAACTTTCCTTCTGGAGAATGCCTT
TTGAAACAATTTTCTCTAGCTGCCTGATGTCAACTGCTTAGTAATCAGTGGATATTGAAA
TATTCAAAATGTACAGAGAGTGGGTAGTGGTGAATGTTTTCATGATGTTGTACGTCCAGC
TGGTGCAGGGCTCCAGTAATGAACATGGACCAGTGAAGCGATCATCTCAGTCCACATTGG
AACGATCTGAACAGCAGATCATGGCTGCTTCTAGTTTGGAGGAACTACTTCGAATTACTC
ACTCTGAGGACTGGAAGCTGTGGAGATGCAGGCTGAGGCTCAAAAGTTTTACCAGTATGG
ACTCTCGCTCATCATCCCATCGGTCCACTAGGTTTGCGGCAACTTTCTATGACATTGAAA
CACTAAAAGTTATAGATGAAGAATGGCAAAGAACTCAGTGCAGCCCTAGAGAAACGTGCG
TGGNAGTGGCCAGTGAGCTGGGGAAGAGTACCACACATTCTTCAGCCCCCTGTGTNGACG
TGTTTCGATGTGGTGGCTGGTGCAATGAAAGAGCCTTATCTGGATGAACACCG
Tag Tag Free
ACCN NM_004469
ORF Size 1065 bp
Insert Size 2106
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004469.2, NP_004460
RefSeq Size 2128
RefSeq ORF 1065
Locus ID 2277
Cytogenetics Xp22.2
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, mTOR signaling pathway, Focal adhesion, Pathways in cancer, Renal cell carcinoma, Pancreatic cancer, Bladder cancer
Gene Summary The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. Read-through transcription has been observed between this locus and the upstream PIR (GeneID 8544) locus. [provided by RefSeq, Feb 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.