FXYD2 (NM_001680) Human Untagged Clone

CAT#: SC121946

FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FXYD2
• Synonyms: ATP1G1; HOMG2
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC121946 sequence for NM_001680 edited (data generated by NextGen Sequencing)
  ATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTAC
  TATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTG
  GGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAA
  ATCAATGAAGATGAGCCGTAA
  
  Clone variation with respect to NM_001680.4
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_001680 unedited
  GCACGAGGAAGAGGGGAGTGGAGGCAGCCCATTCACCTGGGGAAATGACTGGGTTGTCGA
  TGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCG
  TTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCC
  TCAGCAGAAGATTCCNCGGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGC
  CGTAACAGCAGCCTCGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGCAT
  GGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGACCTTTGTCCCCGTCACTG
  CCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCAAC
  TCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCT
  CN
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001680
• Insert Size: 650 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001680.3, NP_001671.2
• RefSeq Size: 546 bp
• RefSeq ORF: 201 bp
• Locus ID: 486
• UniProt ID: P54710
• Cytogenetics: 11q23.3
• Domains: ATP1G1_PLM_MAT8
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Gene Summary: This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (a) represents the most predominant transcript and encodes isoform 1.