NAT2 (NM_000015) Human Untagged Clone

CAT#: SC116108

NAT2 (untagged)-Human N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2)


  "NM_000015" in other vectors (6)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NAT2 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NAT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAT2
Synonyms AAC2; NAT-2; PNAT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC116108 representing NM_000015.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACATTGAAGCATATTTTGAAAGAATTGGCTATAAGAACTCTAGGAACAAATTGGACTTGGAAACA
TTAACTGACATTCTTGAGCACCAGATCCGGGCTGTTCCCTTTGAGAACCTTAACATGCATTGTGGGCAA
GCCATGGAGTTGGGCTTAGAGGCTATTTTTGATCACATTGTAAGAAGAAACCGGGGTGGGTGGTGTCTC
CAGGTCAATCAACTTCTGTACTGGGCTCTGACCACAATCGGTTTTCAGACCACAATGTTAGGAGGGTAT
TTTTACATCCCTCCAGTTAACAAATACAGCACTGGCATGGTTCACCTTCTCCTGCAGGTGACCATTGAC
GGCAGGAATTACATTGTCGATGCTGGGTCTGGAAGCTCCTCCCAGATGTGGCAGCCTCTAGAATTAATT
TCTGGGAAGGATCAGCCTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATCTGGTACCTG
GACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAATTCTCATCTCCTGCCAAAGAAG
AAACACCAAAAAATATACTTATTTACGCTTGAACCTCGAACAATTGAAGATTTTGAGTCTATGAATACA
TACCTGCAGACGTCTCCAACATCTTCATTTATAACCACATCATTTTGTTCCTTGCAGACCCCAGAAGGG
GTTTACTGTTTGGTGGGCTTCATCCTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTC
GAGTTTAAAACTCTCACTGAGGAAGAGGTTGAAGAAGTGCTGAGAAATATATTTAAGATTTCCTTGGGG
AGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_000015
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000015.2
RefSeq Size 1317 bp
RefSeq ORF 873 bp
Locus ID 10
UniProt ID P11245
Cytogenetics 8p22
Domains Acetyltransf2
Protein Families Transmembrane
Protein Pathways Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways
MW 33.6 kDa
Gene Summary This gene encodes an enzyme that functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are responsible for the N-acetylation polymorphism in which human populations segregate into rapid, intermediate, and slow acetylator phenotypes. Polymorphisms in this gene are also associated with higher incidences of cancer and drug toxicity. A second polymorphic arylamine N-acetyltransferase gene (NAT1), is located near this gene (NAT2). [provided by RefSeq, Sep 2019]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.