PICK1 (NM_012407) Human Untagged Clone

CAT#: SC115422

Reviews ()
Write a review

PICK1 (untagged)-Human protein interacting with PRKCA 1 (PICK1), transcript variant 1



Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PICK1
Synonyms PICK; PRKCABP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_012407 edited
GTGGGTTCAGGTACCAGCCTGGCCGGGACCCGGCTGTGGGACCAACGCTTCCGGTGAGCG
ACAGAGGCAGCTCCCCAGGGCCTGGAGACCCGTGGGGCGGACTCTGGGATCTGAGCCTAT
CGCCCTGGCCTGGAGCCCCCCTTTGTACCTATTCCCCATTCCCCTACCGAGCTGGGCAGT
TAGCCAGCCCACTCCAACTCTCGGAACCATGTTTGCAGACTTGGATTATGACATCGAAGA
GGATAAACTCGGAATCCCGACTGTGCCTGGGAAGGTGACCCTGCAGAAGGATGCTCAGAA
CCTGATCGGGATCAGCATTGGAGGAGGGGCCCAGTACTGTCCCTGCCTCTATATCGTCCA
GGTATTTGACAACACCCCAGCAGCCTTGGACGGCACAGTGGCAGCTGGCGATGAGATCAC
CGGTGTCAATGGCAGGTCAATCAAAGGGAAAACTAAGGTGGAGGTGGCGAAGATGATTCA
GGAGGTGAAGGGGGAGGTGACCATCCACTACAACAAGCTGCAGGCGGACCCCAAGCAGGG
CATGTCCCTGGACATTGTGTTGAAGAAAGTCAAGCACCGGCTGGTGGAGAACATGAGTTC
AGGGACCGCAGATGCTCTGGGCCTGAGCCGGGCCATCCTGTGCAATGATGGGCTTGTCAA
GAGGCTAGAGGAGCTGGAGCGGACCGCTGAGCTATACAAAGGGATGACGGAACACACCAA
GAACCTCCTACGGGCCTTTTATGAGCTGTCGCAGACTCACCGGGCCTTTGGGGACGTGTT
CTCCGTGATCGGGGTGCGGGAGCCCCAGCCAGCTGCGAGCGAGGCTTTTGTGAAGTTCGC
CGATGCCCACCGCAGCATCGAGAAGTTCGGCATTCGGCTTCTGAAAACCATCAAGCCGAT
GCTGACGGATCTGAACACGTACCTCAACAAAGCCATCCCGGACACTCGCCTCACCATCAA
GAAGTACCTGGACGTGAAGTTTGAGTACCTGTCGTACTGCCTGAAGGTGAAGGAGATGGA
TGACGAGGAATACAGCTGCATTGCCCTAGGCGAGCCCCTTTACCGGGTGAGCACCGGCAA
CTATGAGTACCGCCTGATCCTGCGCTGCCGCCAGGAGGCGCGCGCCCGCTTCTCCCAGAT
GCGCAAGGATGTGCTGGAGAAGATGGAGCTGCTGGACCAGAAGCACGTCCAGGACATCGT
GTTCCAGCTGCAGCGCCTCGTGTCCACCATGTCCAAGTACTACAACGACTGCTACGCAGT
GCTGCGGGATGCCGACGTCTTCCCCATCGAGGTAGACCTGGCGCACACCACATTGGCCTA
TGGCCTCAACCAGGAGGAGTTCACAGATGGGGAGGAGGAGGAGGAGGAGGAAGACACGGC
AGCTGGGGAGCCGTCCAGGGATACACGAGGGGCTGCTGGGCCCTTGGACAAGGGTGGAAG
CTGGTGTGACTCCTGAGTGCCCCGCGGCTGTGGTGCCGGGGGCAGGGTGCGTGGGAGGAC
GGAGCCTGGGAGCGGGGCGGGGCCGCCGCGCAAGGGGGCGACGCATAAAGGCCTGCTGGC
TTGGGGCGCCTGCCTCCCTGCTCCTCTGTCCTCGCACAGCGAACCTGGGCTCCTGCCCAG
GACAGGCACCAGGGTCATGGCCTGGGACCTGGACACTGGCCCCTCCACCCTCCCTCCCCT
CCCGGCTCCCCGGCCAGAGGGAGAGCTTGGTCTCTGGACCTGCCTTAGGAAGGAGAGGGA
GGGCAGGAAGGAAAAGAAAGGACTTGGAGGTGGCAGGAGTCCGAGCCCTGCTCCTTGTGG
GCGCTCACACTGCCCCCGGAGCCTGCTGGGAGTGGGGCCAGCCGTGGACAGCTGAGGTTG
GGGTCAATGCCTCCTGGGCACCCTTGCCTCGCCCCAGACCGGCCCGTCCAGTCCCCATCA
CACCTCGGCGGCCTTTATTTATTCTGTTCCCCCAGCTCGGCCACTTCTCTGAAGGAGGGC
TGGGTTCTGGGCCTGTATCGAATAAACACAAACCTGGATGGCGCAAAAAAAAAAAAAAAA
AA
Restriction Sites NotI-NotI     
ACCN NM_012407
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_012407.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012407.2, NP_036539.1
RefSeq Size 2083 bp
RefSeq ORF 1248 bp
Locus ID 9463
UniProt ID Q9NRD5
Cytogenetics 22q13.1
Domains PDZ
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.
Other products for "PICK1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.